DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rU

Group 2 - vicinal phosphate

S: AAAAGUAACUAGAGAUGG
specific cleavage at desired position Mg2+
RNA phosphodiester N 50
 Buffer conditions
1 M NaCl, 50 mM Tris-HCl pH 7.5, 10 mM MgCl2
 Catalytic region of the DNAzyme
TGTTTCTCGCTTTGCTGGATGTACTTTT

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2019 Y Wang H Yu A Novel Small RNA-Cleaving Deoxyribozyme with a Short Binding Arm None 10.1038/s41598-019-44750-x RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra