Reaction | Reacting groups | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
specific cleavage at desired position |
UO22+ |
RNA phosphodiester | N 50 |
---|
Buffer conditions |
---|
50 mM MES pH 5.5, 250 mM NaNO3, 0.1 mM UO22+ |
Catalytic region of the DNAzyme |
---|
CTTCATTACCAATAGAGTAACTTCAGAAATAGCAGGCGTGTAGAGAATC |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2007 | J Liu | Y Lu | A catalytic beacon sensor for uranium with parts-per-trillion sensitivity and millionfold selectivity. | 17284609 | 10.1073/pnas.0607875104 | RNA cleavage |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2009 | A K Brown | Y Lu | Biochemical characterization of a uranyl ion-specific DNAzyme. | 19142882 | 10.1002/cbic.200800632 |
RNA cleavage |