DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

specific cleavage at desired position UO22+
RNA phosphodiester N 50
 Buffer conditions
50 mM MES pH 5.5, 250 mM NaNO3, 0.1 mM UO22+
 Catalytic region of the DNAzyme
TGCAGTCGGGTAGTTAAACCGACCTTCAGACATAGGCAGGCGTATATCT

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2007 J Liu Y Lu A catalytic beacon sensor for uranium with parts-per-trillion sensitivity and millionfold selectivity. 17284609 10.1073/pnas.0607875104 RNA cleavage

 Related Publications

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2009 A K Brown Y Lu Biochemical characterization of a uranyl ion-specific DNAzyme. 19142882 10.1002/cbic.200800632 RNA cleavage
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra