| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rC Group 2 - vicinal phosphate |
S: GCGTGCCrCGTCTGTTGGGCCC |
specific cleavage at desired position |
Hg2+ |
RNA phosphodiester | N 40 |
|---|
| Buffer conditions |
|---|
| 5 µm Hg2+, 200 mM NaCl, 5 mM MgCl2, 25 mM Na-cacodylate pH 7.5 |
| Catalytic region of the DNAzyme |
|---|
| CAUAGUGCGUGAGGCUUGCGCUGUCAGCGGUCG |
| Notes |
|---|
| The initial population of sequences for in vitro selection was created by polymerizing the two modified nucleoside triphosphates dA<sup>im</sup>TP and dU<sup>aa</sup>TP onto a template containing 40 degenerate positions. The reported sequences are those of the random regions only. Self-cleaving system. See the SI for further details. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2008 | M Hollenstein | D M Perrin | A Highly Selective DNAzyme Sensor for Mercuric Ions | None | 10.1002/anie.200800960 | RNA cleavage |