DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rC

Group 2 - vicinal phosphate

S: GCGTGCCrCGTCTGTTGGGCCC
specific cleavage at desired position Hg2+
RNA phosphodiester N 40
 Buffer conditions
5 µm Hg2+, 200 mM NaCl, 5 mM MgCl2, 25 mM Na-cacodylate pH 7.5
 Catalytic region of the DNAzyme
UUCUCAUCCGUAGUGAGGGACGCGGCGCUCCCCCGUU
Notes
The initial population of sequences for in vitro selection was created by polymerizing the two modified nucleoside triphosphates dA<sup>im</sup>TP and dU<sup>aa</sup>TP onto a template containing 40 degenerate positions. The reported sequences are those of the random regions only. Self-cleaving system. See the SI for further details.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2008 M Hollenstein D M Perrin A Highly Selective DNAzyme Sensor for Mercuric Ions None 10.1002/anie.200800960 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra