DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

X: Fluorescein (F)- and a DABCYL (Q)-modified deoxyribothymidine.
S: GATGTGTCCGTGCFrAQGGTTCGATTCTTGTGACT
specific cleavage at desired position Co2+
RNA phosphodiester N *
 Buffer conditions
10 mM CoCl2, 5 mM MgCl2, 50 mM HEPES pH 6.8
 kcat/ kobs
kcat = 7.2 min-1
 Catalytic region of the DNAzyme
AAGAATCGTTGTCATTGGCACACGGAGGTTTACTGAGTGGTAACCACGTTGCATGGAA
Notes
Trans-cleaving version of DEC22-18.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2003 S H J Mei Y Li An efficient RNA-cleaving DNA enzyme that synchronizes catalysis with fluorescence signaling. 12517153 10.1021/ja0281232 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra