DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

X: Fluorescein (F)- and a DABCYL (Q)-modified deoxyribothymidine.
S: cleavage in cis
specific cleavage at desired position Co2+
RNA phosphodiester N 43
 Buffer conditions
50 mM HEPES pH 6.8, 400 mM NaCl, 200 mM KCl, 7.5 mM MgCl2, 5 mM MnCl2, 1.25 mM CdCl2, 1 mM CoCl2, 0.25 mM NiCl2
 kcat/ kobs
kobs = 1 min-1
 Catalytic region of the DNAzyme
GATGTGTCCGTGCFAQGGTTCGATTCTTGATCGTTGTCATTGGCACACGGAGGTTTACTGAGTGGTAACCACGTTGCATGGAATTCGGTAAGCTTGGCACCCGCATCGT
Notes
A deletion mutant of DEC22-18 termed DEC22-18A works optimally in the absence of monovalent ions and displays a k<sub>obs</sub> = 10 min<sup>-1</sup>.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2003 S H J Mei Y Li An efficient RNA-cleaving DNA enzyme that synchronizes catalysis with fluorescence signaling. 12517153 10.1021/ja0281232 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra