Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description |
---|---|---|---|---|---|---|
DNA cleavage |
Group 1 - H2O |
S: * |
hydrolyzed DNA |
Zn2+ |
DNA phosphodiester | N 100* |
Buffer conditions |
---|
50 mM HEPES pH 7.0 , 100 mM NaCl, 20 mM MgCl2, 2 mM ZnCl2 |
Yield (%) | kcat/ kobs |
---|---|
50-60 | kobs = 0.059 min-1 |
Catalytic region of the DNAzyme |
---|
GGTGCTACAGCCATAGTTGAGCAATTAGTTGAAGTGGCTGTACA |
Notes |
---|
Members of the single-stranded DNA pool contain two 15 nt primer binding sites (5′ and 3′ termini) and two 50 nt random-sequence domains linked by a 15 nt bridge (middle). They are 145 nt-long. Self hydrolyzing. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2013 | H Gu | R R Breaker | Small, highly active DNAs that hydrolyze DNA. | 23679108 | 10.1021/ja403585e | DNA cleavage |