Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description |
---|---|---|---|---|---|---|
RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: CTCTATCTATrAGGAAGTACCGCCGC |
specific cleavage at desired position |
Na+ |
RNA phosphodiester | N * |
Buffer conditions |
---|
* |
Yield (%) | kcat/ kobs |
---|---|
>80 | kobs = 0.1 min-1 |
Catalytic region of the DNAzyme |
---|
GCGGCGGTACCAGGTCAAAGGTGGGTGAGGGGACGCCAAGAGTCCCCGCGGTTAGATAGAG |
Notes |
---|
Truncated DNAzymes derived from NaA43 (trans-cleaving) |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2015 | S-F Torabi | Y Lu | In vitro selection of a sodium-specific DNAzyme and its application in intracellular sensing | None | 10.1073/pnas.1420361112 | RNA cleavage |