Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description |
---|---|---|---|---|---|---|
RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: * |
specific cleavage at desired position |
Na+ |
RNA phosphodiester | N 50 |
Buffer conditions |
---|
50 mM Bis-Tris pH 7.0, 1 mM EDTA, 10 mM sodium citrate, 370 mM NaCl |
Catalytic region of the DNAzyme |
---|
GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACAAGGTCAAAGGTTGGTGTTTCAATGTGATGTCATCACATGAAGTGGTTACGTGAGCCTACGATGAGAC |
Notes |
---|
This is the cis-cleaving version of the DNAzyme. Sequences have been annotated as reported. The cleavage site rA is in position 23 in the reported sequence. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2015 | S-F Torabi | Y Lu | In vitro selection of a sodium-specific DNAzyme and its application in intracellular sensing | None | 10.1073/pnas.1420361112 | RNA cleavage |