DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

S: *
specific cleavage at desired position Na+
RNA phosphodiester N 50
 Buffer conditions
50 mM Bis-Tris pH 7.0, 1 mM EDTA, 10 mM sodium citrate, 105 mM NaCl
 Catalytic region of the DNAzyme
CTTCACACTAATCATCACCTATACCAACTACCCCATZCTACCACCTCAAACCTC CCTC ACCCCACCCCAACACTCCCCCCCCTTACCTCATCTCACCCTACCATCACAC
Notes
This is the cis-cleaving version of the DNAzyme. Sequences have been annotated as reported. The cleavage site rA is in position 23 in the reported sequence.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2015 S-F Torabi Y Lu In vitro selection of a sodium-specific DNAzyme and its application in intracellular sensing None 10.1073/pnas.1420361112 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra