Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description |
---|---|---|---|---|---|---|
RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: * |
specific cleavage at desired position |
Na+ |
RNA phosphodiester | N 50 |
Buffer conditions |
---|
50 mM Bis-Tris pH 7.0, 1 mM EDTA, 10 mM sodium citrate, 105 mM NaCl |
kcat/ kobs |
---|
kobs = 0.1 min-1 |
Catalytic region of the DNAzyme |
---|
GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCAGGTCAAAGGTGGGTGAGGGGACGCCAAGAGTCCCCGCGGTTACGTGATGTGAGCCTACGATGAGAC |
Notes |
---|
This is the cis-cleaving version of the DNAzyme. Sequences have been annotated as reported. The cleavage site rA is in position 23 in the reported sequence. The trans-cleaving DNAzyme is annotated as NaA43E. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2015 | S-F Torabi | Y Lu | In vitro selection of a sodium-specific DNAzyme and its application in intracellular sensing | None | 10.1073/pnas.1420361112 | RNA cleavage |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2019 | L Ma | J Liu | From general base to general acid catalysis in a sodium-specific DNAzyme by a guanine-to-adenine mutation | None | 10.1093/nar/gkz578 |
RNA cleavage |
2019 | L Ma | J Liu | An in Vitro-Selected DNAzyme Mutant Highly Specific for Na under Slightly Acidic Conditions. | 29989277 | 10.1002/cbic.201800322 |
RNA cleavage |
2016 | W Zhou | J Liu | A DNAzyme requiring two different metal ions at two distinct sites. | 26657636 | 10.1093/nar/gkv1346 |
RNA cleavage |
2015 | S-F Torabi | Y Lu | Identification of the Same Na(+)-Specific DNAzyme Motif from Two In Vitro Selections Under Different Conditions. | 26577294 | 10.1007/s00239-015-9715-7 |
RNA cleavage |