| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: * |
specific cleavage at desired position |
Ce3+ |
RNA phosphodiester | N * |
|---|
| Buffer conditions |
|---|
| * |
| Catalytic region of the DNAzyme |
|---|
| TTTCGCCATCTTTACAAGGAAGGATGCACAACGGTTATAGTGACTCGTGAC |
| Notes |
|---|
| Truncated DNAzymes derived from Lu1 (trans-cleaving) |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2014 | P-J J Huang | J Liu | In vitro selection of a new lanthanide-dependent DNAzyme for ratiometric sensing lanthanides. | 25199650 | 10.1021/ac5029962 | RNA cleavage |