DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

S: *
specific cleavage at desired position Ce3+
RNA phosphodiester N *
 Buffer conditions
*
 Catalytic region of the DNAzyme
TTTCGCCATCTTTACAAGGAAGGATGCACAACGGTTATAGTGACTCGTGAC
Notes
Truncated DNAzymes derived from Lu1 (trans-cleaving)

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2014 P-J J Huang J Liu In vitro selection of a new lanthanide-dependent DNAzyme for ratiometric sensing lanthanides. 25199650 10.1021/ac5029962 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra