Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: * |
specific cleavage at desired position |
Lu3+ |
RNA phosphodiester | N 35 |
---|
Buffer conditions |
---|
50 mM MES pH 6.0, 25 mM NaCl, Lu3+ |
Catalytic region of the DNAzyme |
---|
CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCRCAAGGAAGGGCCACTATGCACAACGGTTATAGTGACGGTAAGCTTGGCAC |
Notes |
---|
This is the cis-cleaving version of the DNAzyme. Sequences have been annotated as reported. The cleavage site rA is in position 28 in the reported sequence. The thymine at position 48 is the starting of the N35 region. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2014 | P-J J Huang | J Liu | In vitro selection of a new lanthanide-dependent DNAzyme for ratiometric sensing lanthanides. | 25199650 | 10.1021/ac5029962 | RNA cleavage |