DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

S: *
specific cleavage at desired position Nd3+
RNA phosphodiester N 35
 Buffer conditions
50 mM MES pH 6.0, 25 mM NaCl, Lu3+
 Yield (%) kcat/ kobs
>60 kobs = 0.12 min-1
 Catalytic region of the DNAzyme
CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTACAAGGAACGGTTATAGTGAAAGGAAACTCGTAGTCGGTAAGCTTGGCAC
Notes
This is the cis-cleaving version of the DNAzyme. Sequences have been annotated as reported. The cleavage site rA is in position 28 in the reported sequence. The thymine at position 48 is the starting of the N35 region. Can be engineered easily into a trans-cleaving system.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2014 P-J J Huang J Liu In vitro selection of a new lanthanide-dependent DNAzyme for ratiometric sensing lanthanides. 25199650 10.1021/ac5029962 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra