DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

S: GTCACGAGTCACTATrAGGAAGATGGCGAAA
Ag+
RNA phosphodiester N *
 Buffer conditions
pH 7.5, 200 mM NaNO3, 10 μM AgNO3
 Yield (%) kcat/ kobs
60 kobs = 0.41 min-1
 Catalytic region of the DNAzyme
TAGGTGATTTCCACGATTATGCGGAAACAGGGCAGCGT
Notes
Truncated version of Ag10

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2016 R Saran J Liu A Silver DNAzyme. 26977895 10.1021/acs.analchem.6b00327 RNA cleavage

 Related Publications

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2017 R Saran J Liu A Silver-Specific DNAzyme with a New Silver Aptamer and Salt-Promoted Activity. 28345892 10.1021/acs.biochem.6b01131 RNA cleavage
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra