DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

S: GTCACGAGTCACTATrAGGAAGATGGCGAAA
Ag+
RNA phosphodiester N 50
 Buffer conditions
50 mM MES pH 6.0, 25 mM NaNO3, 10 μM AgNO3
 Catalytic region of the DNAzyme
GCGGAACCCACCTACACGGATGGCT
Notes
Engineered to act in trans based on the in vitro selected sequences. No significant cleavage observed.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2016 R Saran J Liu A Silver DNAzyme. 26977895 10.1021/acs.analchem.6b00327 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra