Reaction | Reacting groups | Substrates | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: GTCACGAGTCACTATrAGGAAGATGGCGAAA |
Ag+ |
RNA phosphodiester | N 50 |
---|
Buffer conditions |
---|
50 mM MES pH 6.0, 25 mM NaNO3, 10 μM AgNO3 |
Catalytic region of the DNAzyme |
---|
AACGCGCACGGCGGAACCCAC |
Notes |
---|
Engineered to act in trans based on the in vitro selected sequences. No significant cleavage observed. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2016 | R Saran | J Liu | A Silver DNAzyme. | 26977895 | 10.1021/acs.analchem.6b00327 | RNA cleavage |