Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA ligation |
Group 1 - 2',3 '- diol Group 2 - 5'-triphosphate |
L: GGAACUGCGAUCUAGUGA R: GACUGACUCGUGAUCGGA |
native RNA |
Mn2+ Mg2+ |
3',5' | N 22 |
---|
Buffer conditions |
---|
50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM atrazine, 10% methanol |
Catalytic region of the DNAzyme |
---|
GGTTCGGGGTATGCGGAGGCAT |
Notes |
---|
In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2013 | A K Behera | A Baum | Enhanced deoxyribozyme‐catalyzed RNA ligation in the presence of organic cosolvents | None | 10.1002/bip.22191 | RNA ligation |