| Reaction | Substrates | Product | Metal ion | Seq description | DNA depurination |
S: GAGCTACGTTTTTTTGGAAGAGATGGCGACTACAA |
Cleavage of the N-glycosidic bond of residue G17 |
Mn2+ Mg2+ Ca2+ Ba2+ |
N * |
|---|
| Buffer conditions |
|---|
| 10 mM MgCl2, 150 mM NaCl, 1 mM spermine, 0.01% SDS, 50 mM Hepes pH 7.5 |
| kcat/ kobs |
|---|
| kobs = 0.2 min-1 |
| Catalytic region of the DNAzyme |
|---|
| TGGCGACTACAAAGATATTCTCGGGCAGTTAATGCTTATTGATATCTC |
| Notes |
|---|
| The original goal of the in vitro selection was to select for an O-glycosidase DNA enzyme that could cleave a target disaccharide, instead, N-glycosylase activity emerged. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2000 | T L Sheppard | G F Joyce | A DNA enzyme with N-glycosylase activity. | 10884411 | 10.1073/pnas.97.14.7802 | DNA depurination |