| Reaction | Substrates | Metal ion | Seq description | DNA cleavage |
S: GGATAATACGACTCACTATTTGAAGAGATGGCGACTTCG |
Mg2+ Zn2+ |
N 40 |
|---|
| Buffer conditions |
|---|
| 70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl |
| Yield (%) | kcat/ kobs |
|---|---|
| 50-60 | kobs = 0.20 h-1 |
| Catalytic region of the DNAzyme |
|---|
| TAAGGGAGGTACGATACACGCCACTTGCACGTTGTGGCGA |
| Notes |
|---|
| This DNAzyme catalyzes a radical-based reaction pathway that results in excision of most atoms of a specific guanosine nucleoside. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2017 | Y Lee | S K Silverman | DNA-Catalyzed DNA Cleavage by a Radical Pathway with Well-Defined Products. | 27935689 | 10.1021/jacs.6b10274 | DNA cleavage |