| Reaction | Substrates | Metal ion | Linkage | Seq description | Covalent Modification of Amino Acid Side Chains |
L: GGATAATACGXTTCACTGCG R: 5'-triphosphate RNA X: X = Ala-Lys-Ala |
Mn2+ |
pyrophosphoramidate | N * |
|---|
| Buffer conditions |
|---|
| 50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2, 40 mM MgCl2 |
| Catalytic region of the DNAzyme |
|---|
| CAACATAAGGGAGGAGCAAATGAAAAATGTCAGGCGCAGTGAGTTTACGG |
| Notes |
|---|
| The selection aimed at the isolation of DNA catalysts capable of modifying Lys using the 3HJ preorganized architecture. However, the in vitro selection resulted in a DNA-catalyzed reaction between a phosphoramidate functional group in the substrate and 5′-triphosphate-RNA, forming an unusual pyrophosphoramidate linkage. The pool is N<sub>33</sub>-CGCAGTGAG-N<sub>7</sub>. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2012 | A Sachdeva | S K Silverman | DNA-catalyzed reactivity of a phosphoramidate functional group and formation of an unusual pyrophosphoramidate linkage. | 22042295 | 10.1039/c1ob06088k | Covalent Modification of Amino Acid Side Chains |