Reaction | Reacting groups | Substrates | Metal ion | Seq description | Diels-Alder |
Group 1 - Anthracene Group 2 - DTME (dithiobismaleimidoethane) |
L: DTME R: DNA-HEG-anthracene |
Mn2+ Mg2+ Zn2+ Ca2+ Cu2+ Co2+ |
N * |
---|
Buffer conditions |
---|
50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 µM MnCl2, 5 µM CoCl2, 5 µM CuCl2, 5 µM ZnCl2, |
Catalytic region of the DNAzyme |
---|
AGGGGGATGTTCGGATTGTCCGGGGAATACCTAGG |
Notes |
---|
Partially randomized catalytic region based on the 39M49 ribozyme, synthesized as DNA. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2008 | M Chandra | S K Silverman | DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation. | 18271591 | 10.1021/ja7111965 | Diels-Alder |