Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | Tyrosine azido‐adenylylation |
Group 1 - Tyrosine's hydroxyl Group 2 - 2′‐Az‐dATP |
L: DNA-anchored CLQTYPRT octapeptide R: 2′‐Az‐dATP |
Azido-adenylated peptide |
Mn2+ Mg2+ Zn2+ |
phosphodiester | N 40 |
---|
Buffer conditions |
---|
70 mm HEPES pH 7.5, 1 mm ZnCl2, 20 mm MnCl2, 40 mm MgCl2, 150 mm NaCl |
Catalytic region of the DNAzyme |
---|
GTGTCCTAGTAAGAGTGATGGGGGTAGGGACCCCCGCGAC |
Notes |
---|
Natural ATP is generally tolerated well in place of 2′‐Az‐dATP. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2016 | P Wang | S K Silverman | DNA-Catalyzed Introduction of Azide at Tyrosine for Peptide Modification. | 27391404 | 10.1002/anie.201604364 | Tyrosine azido‐adenylylation |