Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description |
---|---|---|---|---|---|---|
RNA cleavage |
Group 1 - H2O |
S: AAAGUCUCAUGUACUUAUAUGUUCUAGCGCGGA |
hydrolyzed RNA |
Mn2+ Mg2+ Zn2+ |
RNA phosphodiester | N 40 |
Buffer conditions |
---|
70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl |
kcat/ kobs |
---|
kobs = 0.12 h-1 |
Catalytic region of the DNAzyme |
---|
GGCTAGAATAGTGGGGGCGATTGATCTAGGGGGCGCTTAA |
Notes |
---|
Partially randomized catalytic region based on 10MD5 sequence |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2013 | D J Parker | S K Silverman | DNA catalysis of a normally disfavored RNA hydrolysis reaction. | 23697866 | 10.1021/ja4032488 | RNA cleavage |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2009 | M Chandra | S K Silverman | DNA-catalyzed sequence-specific hydrolysis of DNA | None | 10.1038/nchembio.201 |
DNA cleavage |