Reaction | Reacting groups | Substrates | Product | Metal ion | Seq description | Covalent Modification of Amino Acid Side Chains |
Group 1 - Tyrosine's hydroxyl Group 2 - 5'-triphosphate |
L: Azido-AYA peptide R: 5′-triphosphate-RNA |
nucleopeptide linkage |
Zn2+ |
N 40 |
---|
Buffer conditions |
---|
70 mM HEPES pH 7.5, 1 mM ZnCl2, 150 mM NaCl |
Catalytic region of the DNAzyme |
---|
ACGACTTGAAGATTAAGTGGCTCGGGTAATTTTTAGGTTA |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2014 | C Chu | S K Silverman | A generalizable DNA-catalyzed approach to peptide-nucleic acid conjugation. | 25056930 | 10.1002/cbic.201402255 | Covalent Modification of Amino Acid Side Chains |