| Reaction | Reacting groups | Substrates | Product | Metal ion | Seq description | Covalent Modification of Amino Acid Side Chains |
Group 1 - Tyrosine's hydroxyl Group 2 - 5'-triphosphate |
L: Azido-AYA peptide R: 5′-triphosphate-RNA |
nucleopeptide linkage |
Mn2+ Mg2+ Zn2+ |
N 40 |
|---|
| Buffer conditions |
|---|
| 70 mM HEPES pH 7.5, 40 mM MgCl2, 20 mM MnCl2, 1 mM ZnCl2, 150 mM NaCl |
| Yield (%) | kcat/ kobs |
|---|---|
| 45 | kobs = 0.41 h-1 |
| Catalytic region of the DNAzyme |
|---|
| GGGAGATGTCTCTCAGACGGAAACTTTCAGTACGGAATGG |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2014 | C Chu | S K Silverman | A generalizable DNA-catalyzed approach to peptide-nucleic acid conjugation. | 25056930 | 10.1002/cbic.201402255 | Covalent Modification of Amino Acid Side Chains |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2016 | C Chu | S K Silverman | Assessing histidine tags for recruiting deoxyribozymes to catalyze peptide and protein modification reactions. | 27138704 | 10.1039/c6ob00716c |
Tyrosine Phosphorylation Covalent Modification of Amino Acid Side Chains |