Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | Covalent Modification of Amino Acid Side Chains |
Group 1 - Serines's hydroxyl Group 2 - 5'-triphosphate |
L: GGATAATACGXTTCACTGCG R: 5′-triphosphate-RNA X: Ala-Ser-Ala |
nucleopeptide linkage |
Mn2+ |
Ser-RNA | N * |
---|
Buffer conditions |
---|
50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2, 40 mM MgCl2 |
Yield (%) | kcat/ kobs |
---|---|
80 | kobs = 0.40 h-1 |
Catalytic region of the DNAzyme |
---|
CAGACGTACCGGACTGACAGCAAGATTGTTAGTAAGTACGCAGTGAGTGTAGCG |
Notes |
---|
Pool has been designed to adopt a 3HJ architecture, and it's sequence is 5'-P3-N<sub>33</sub>-P1-N<sub>7</sub>-P4-P2-3'. The catalytic region has been annotated as follows N<sub>33</sub>-P1-N<sub>7</sub>. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2010 | A Sachdeva | S K Silverman | DNA-catalyzed serine side chain reactivity and selectivity. | 20234910 | 10.1039/b927317d | Covalent Modification of Amino Acid Side Chains |