DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
Covalent Modification of Amino Acid Side Chains Group 1 - Serines's hydroxyl

Group 2 - 5'-triphosphate

L: GGATAATACGXTTCACTGCG
R: 5′-triphosphate-RNA
X: Ala-Ser-Ala
nucleopeptide linkage Mn2+
Ser-RNA N *
 Buffer conditions
50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2, 40 mM MgCl2
 Yield (%) kcat/ kobs
80 kobs = 0.40 h-1
 Catalytic region of the DNAzyme
CTACAGTCGAGTAATGTAGTCAGCAAGATCGTCAACGCAGTGAGTGTAGCG
Notes
Pool has been designed to adopt a 3HJ architecture, and it's sequence is 5'-P3-N<sub>33</sub>-P1-N<sub>7</sub>-P4-P2-3'. The catalytic region has been annotated as follows N<sub>33</sub>-P1-N<sub>7</sub>.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2010 A Sachdeva S K Silverman DNA-catalyzed serine side chain reactivity and selectivity. 20234910 10.1039/b927317d Covalent Modification of Amino Acid Side Chains

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra