| Reaction | Reacting groups | Substrates | Metal ion | Linkage | Seq description | Covalent Modification of Amino Acid Side Chains |
Group 1 - * Group 2 - 5′-phosphorimidazolide |
L: *DNA-HEG-CKA tripeptide R: 5′-phosphorimidazolide-activated DNA oligonucleotide |
Mn2+ Zn2+ |
phosphoramidate (P–N) linkage | N 40 |
|---|
| Buffer conditions |
|---|
| 70 mM HEPES pH 7.5 with 40 mM MgCl2, 20 mM MnCl2, 1 mM ZnCl2, 150 mM NaCl |
| kcat/ kobs |
|---|
| kobs = 0.17 h-1 |
| Catalytic region of the DNAzyme |
|---|
| TAGCTGTCTAGGACCTATCGTACTGAGAATCATTCCAAAG |
| Notes |
|---|
| The DNA anchor alone (lacking both HEG tether and CKA peptide) was sufficient for reactivity, indicating that the nucleophile for 9DT114-catalyzed reaction with 5′-Imp is on the DNA anchor itself. Detailed investigation revealed that the nucleophile is the C4-NH2 group of a particular deoxycytidine. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2014 | B M Brandsen | S K Silverman | DNA-catalyzed lysine side chain modification. | 24981820 | 10.1002/anie.201404622 | Covalent Modification of Amino Acid Side Chains |