DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates  Metal ion Linkage  Seq description
Covalent Modification of Amino Acid Side Chains Group 1 - aliphatic amino group

Group 2 - 5′-phosphorimidazolide

L: DNA-C3-NH2
R: 5′-phosphorimidazolide-activated DNA oligonucleotide
Mg2+
phosphoramidate (P–N) linkage N 40
 Buffer conditions
50 mM CHES pH 9.0 with 40 mM MgCl2, 150 mM NaCl
 Catalytic region of the DNAzyme
ACGGGAAGCGACGAAGGCTTCAAGAAGGGACTAGGACATA

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2014 B M Brandsen S K Silverman DNA-catalyzed lysine side chain modification. 24981820 10.1002/anie.201404622 Covalent Modification of Amino Acid Side Chains

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra