| Reaction | Reacting groups | Substrates | Metal ion | Linkage | Seq description | Covalent Modification of Amino Acid Side Chains |
Group 1 - aliphatic amino group Group 2 - 5′-phosphorimidazolide |
L: DNA-C3-NH2 R: 5′-phosphorimidazolide-activated DNA oligonucleotide |
Mg2+ |
phosphoramidate (P–N) linkage | N 40 |
|---|
| Buffer conditions |
|---|
| 50 mM CHES pH 9.0 with 40 mM MgCl2, 150 mM NaCl |
| Catalytic region of the DNAzyme |
|---|
| AGTGGTGCGCGTCACCCAACGCCAAAAGCGCTGTAACATA |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2014 | B M Brandsen | S K Silverman | DNA-catalyzed lysine side chain modification. | 24981820 | 10.1002/anie.201404622 | Covalent Modification of Amino Acid Side Chains |