DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates  Metal ion Linkage  Seq description
Covalent Modification of Amino Acid Side Chains Group 1 - aliphatic amino group

Group 2 - 5′-phosphorimidazolide

L: DNA-C3-NH2
R: 5′-phosphorimidazolide-activated DNA oligonucleotide
Mg2+
phosphoramidate (P–N) linkage N 40
 Buffer conditions
50 mM CHES pH 9.0 with 40 mM MgCl2, 150 mM NaCl
 kcat/ kobs
kobs = 0.03 h-1
 Catalytic region of the DNAzyme
AGCAGCAATATGTCGCGGTATAGAGAGGATTGACTTGCGT

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2014 B M Brandsen S K Silverman DNA-catalyzed lysine side chain modification. 24981820 10.1002/anie.201404622 Covalent Modification of Amino Acid Side Chains

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra