DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Substrates Product  Metal ion  Seq description
DNA cleavage S: CTACCTTTATGCGTATCGAAGGAGGCTTTCGgga
deglycosylated DNA Mn2+
N 40
 Buffer conditions
50 mM HEPES pH 7.5, 150 mM NaCl, 20 mM MnCl2
 Catalytic region of the DNAzyme
AAGCCAGATGTATTCCTCCTACCGCGGACCGAGGATGGGA

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2012 V Dokukin S K Silverman Lanthanide ions as required cofactors for DNA catalysts None 10.1039/C2SC01067D DNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra