Reaction | Substrates | Product | Metal ion | Seq description | DNA cleavage |
S: CTACCTTTATGCGTATCGAAGGAGGCTTTCGgga |
deglycosylated DNA |
Mn2+ |
N 40 |
---|
Buffer conditions |
---|
50 mM HEPES pH 7.5, 150 mM NaCl, 20 mM MnCl2 |
Catalytic region of the DNAzyme |
---|
AACCGTGGCAGCAGATCCTCAAGCGGGGAAGACAGCAGTA |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2012 | V Dokukin | S K Silverman | Lanthanide ions as required cofactors for DNA catalysts | None | 10.1039/C2SC01067D | DNA cleavage |