| Reaction | Substrates | Product | Metal ion | Seq description | DNA cleavage |
S: CTACCTTTATGCGTATCGAAGGAGGCTTTCGgga |
deglycosylated DNA |
Mn2+ |
N 40 |
|---|
| Buffer conditions |
|---|
| 50 mM HEPES pH 7.5, 150 mM NaCl, 20 mM MnCl2 |
| Catalytic region of the DNAzyme |
|---|
| TAGAGAGCCCAGGAATTAGTCAGTCCCGGGTTACGAAAAG |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2012 | V Dokukin | S K Silverman | Lanthanide ions as required cofactors for DNA catalysts | None | 10.1039/C2SC01067D | DNA cleavage |