{
"196": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CACGTGGACTTGGCATGGTCCCAGCGCTAGTTTTAAGCGC",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAUCG",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6CA4",
"notes": "",
"r": "GAAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"197": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CCCGTACACGACTGTGGTGTTGAACGGCTGCTAGCCGGCA",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAUCG",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6CA6",
"notes": "",
"r": "GAAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"198": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CACGTACACTTGGTATGGTGTGACACCTCAGCTCATACAT",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAUCG",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6CA10",
"notes": "",
"r": "GAAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"199": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CCCGTGACATTCATATGGGGTCGGTTCCAATCGCGAATTA",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAUCG",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6CA15",
"notes": "",
"r": "GAAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"200": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CCCGTACACTCGACGTGGTGACGCTGTGGCGTGAGCCTGT",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAUCG",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6CA16",
"notes": "",
"r": "GAAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"201": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CAGAGATGGGGTGTGATCTGGGTTGATAACACGGAGCGGTC",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAUCG",
"length": 41,
"linkage": "3',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6CA18",
"notes": "",
"r": "GAAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"202": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CCCGTACACTTAGAATGGTGCAGCCAGCATGCTGTACAGTA",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAUCG",
"length": 41,
"linkage": "3',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6CA21",
"notes": "",
"r": "GAAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"203": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CCCGTGCACTCTATGATGGTGTCCCCTGATACCAACAGGG",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAUCG",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6CA23",
"notes": "",
"r": "GAAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"204": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CACGTGACCTCAGGAATGGGTTCGAGGTGGGTGCACCTGC",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAUCG",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6CA27",
"notes": "",
"r": "GAAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"205": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CCCGTACGCTGCCATGGCGCCATTCTGGCACGTAGTGTTG",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAUCG",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6CA30",
"notes": "",
"r": "GAAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"206": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "GGAACGCAGTCGCACGTGACTAGGGAATCGTATCCTCATG",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "9BX1",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"207": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CGTGGTTTCCGGAATGCCTAGCGTTCAAGTGTGGATGCTT",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "9BX3",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"208": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CCGCGAGGCCGTGGCCCGAGTTGGTCAAAGCACAACGAGT",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "9BX4",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"209": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "GATGTGGTCCAGCTGATAGGGCAGCGTTAGGCATACGTTG",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "9BX10",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"210": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "GCGACGGATTTAGGTGTGTTAGACAGGGTCGGGAATAGAT",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "9BX15",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"211": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "GCAGCGGGGAAGGCACTTCCAGGCAGGGGGGAAAAACAA",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 39,
"linkage": "3',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "9BX16",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"212": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CGAGGCGTAGGTTAATTACAAACGGCTCAGACAACGTATG",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 40,
"linkage": "U16",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6BX6",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"213": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "GGCGAAGGGACTACGTTGGCCATGCGGGTGGGCCGCTATG",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 40,
"linkage": "U16",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6BX35",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"214": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "GAACGTGAGGTGCGGGAATTAATCACAAACCGGAAACGGA",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 40,
"linkage": "A17",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6BX39",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"215": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CACCACAATGGTTGATGCCGGGCCAAGTGGCGCAGCATAC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 40,
"linkage": "A17",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6BX43",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"216": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CGCACGGAGCCCGTTAGGGGTCCACGGAGTGGGTGAACCT",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 40,
"linkage": "A17",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6BX45",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"217": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CCGGGCATCAAGTGCGCAACGATGACGAAATCGGGTGGGT",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 40,
"linkage": "A17",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6BX47",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"218": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CGCACGGTCTGGTGTGGAAGCCAGGTTGCCTCCCTGCAAA",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 40,
"linkage": "A18",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6BX20",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"219": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CAGGGGGAGCGAGCACTAATACAAGCGGGTAGGAGGCCCT",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 40,
"linkage": "A18",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6BX22",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"220": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CGGGAGGAGGCAAAGGCTAGTTTGTCGGATAGGAGGCCCT",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 40,
"linkage": "A18",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6BX23",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"221": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CGTGGGAGCCATTGGGAGGGGCTGAGAACATAAGTCACGA",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 40,
"linkage": "A18",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6BX34",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"222": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "GCAGTGCAAATGAGGCATGGAGAAACTACTCTATGCTGAA",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 40,
"linkage": "C19",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6BX8",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"223": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "GCAGTGCAAATGAGTAAGGACTGATATCAGTCACTACGAA",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 40,
"linkage": "C19",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6BX16",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"224": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "GCAGTGCTAATGAGGGTGTGGCAGAAGCTATACAGCCGAA",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 40,
"linkage": "C19",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6BX40",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"225": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "GCAGTGCTAATGAGGTATCGCAAATAAGTGCGCAGCCGAA",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 40,
"linkage": "C19",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6BX42",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"226": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "GACGGGTGGGGAAATCAGCCTGTATTGGGTTCAGAGCGGA",
"fg1s": [
"2',3' - diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6BX19",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"227": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "GACGACAGCGGTTCCCAGCTCAGTAGTGATAGTTTACTGC",
"fg1s": [
"2',3' - diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6BX21",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"228": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "GACACCGAGCAGAGGACCGGACCTAGTTGGTAAAAGGTAA",
"fg1s": [
"2',3' - diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6BX26",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"229": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CACAGGCGCGCGAGGGGCTATGTCCGGTGGTGCAGGCGGA",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAUCG",
"length": 40,
"linkage": "U16",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6CA17",
"notes": "",
"r": "GAAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"230": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CGGAAGGATGACAAGGAGCGTAGCTGATGGGGACTCAGAC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAUCG",
"length": 40,
"linkage": "A17",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6CA28",
"notes": "",
"r": "GAAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"231": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "GGGGCGTAGTGGAGACCGGGGACAGTGGAGTACGTCCAGC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAUCG",
"length": 40,
"linkage": "U18",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6CA2",
"notes": "",
"r": "GAAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"232": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "GTTAACGCAGGGCGTCGTACTACATCCTTGTGCAGCTACG",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAUCG",
"length": 40,
"linkage": "C19",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6CA20",
"notes": "",
"r": "GAAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"233": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "TGAAGCGCGTTATCCATGCAAAAAATGGATCCGGTACCAAC",
"fg1s": [
"2',3' - diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAUCG",
"length": 41,
"linkage": "2',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6CA1",
"notes": "",
"r": "GAAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"234": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "TGCAGCGGCTGCGCGGGTATCCGGTCTCCAGGGGACGCTT",
"fg1s": [
"2',3' - diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAUCG",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6CA5",
"notes": "",
"r": "GAAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"235": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "AGACCCAGTGTTCTCAGCCGCCCGCCGCAGCGGGGAGGTA",
"fg1s": [
"2',3' - diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAUCG",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6CA7",
"notes": "",
"r": "GAAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"236": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CGAAGACGAGGAGTAACCTTAGATGAAGGTGGGGACGATT",
"fg1s": [
"2',3' - diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAUCG",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6CA14",
"notes": "",
"r": "GAAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"237": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "GGGCGAGGACCGGGTACTAGGGGAACACGCCGCACGCGGG",
"fg1s": [
"2',3' - diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAUCG",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6CA24",
"notes": "",
"r": "GAAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"238": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "AGACGCAGTGTCAGGGTACCACAGACATGTGGAGTGGCTG",
"fg1s": [
"2',3' - diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAUCG",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "6CA25",
"notes": "",
"r": "GAAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"239": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "CATGCGTGTTGCGTGGATACGAGGCTATTCAGAGGGTAAA",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAACA",
"length": 40,
"linkage": "C19",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "9BX11",
"notes": "",
"r": "GUAUGUUCUAGCGCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"240": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40mM MgCl2",
"e": "TTCGGTGGAGGTAAGCTCTG",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 20,
"linkage": "2',5'",
"main_article_first_author": "A Flynn-Charlebois",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T K Prior, K A Hoadley",
"main_article_pub_date": "2003",
"main_article_title": "In vitro evolution of an RNA-cleaving DNA enzyme into an RNA ligase switches the selectivity from 3'-5' to 2'-5'.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "7P4",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.42 (h-1)",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "15"
},
"241": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40mM MgCl2",
"e": "TTCTGCGCAGGTAAGCTGTA",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 20,
"linkage": "2',5'",
"main_article_first_author": "A Flynn-Charlebois",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T K Prior, K A Hoadley",
"main_article_pub_date": "2003",
"main_article_title": "In vitro evolution of an RNA-cleaving DNA enzyme into an RNA ligase switches the selectivity from 3'-5' to 2'-5'.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "7Q2",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.32 (h-1)",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "10-15"
},
"242": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40mM MgCl2",
"e": "TTTGTGGAGGTAAGCTCTG",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 19,
"linkage": "2',5'",
"main_article_first_author": "A Flynn-Charlebois",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T K Prior, K A Hoadley",
"main_article_pub_date": "2003",
"main_article_title": "In vitro evolution of an RNA-cleaving DNA enzyme into an RNA ligase switches the selectivity from 3'-5' to 2'-5'.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "7Q5",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 1.1 (h-1)",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "10"
},
"243": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40mM MgCl2",
"e": "TTACGTGGAGGTGGGCTCTA",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 20,
"linkage": "2',5'",
"main_article_first_author": "A Flynn-Charlebois",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T K Prior, K A Hoadley",
"main_article_pub_date": "2003",
"main_article_title": "In vitro evolution of an RNA-cleaving DNA enzyme into an RNA ligase switches the selectivity from 3'-5' to 2'-5'.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "7Q10",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.19 (h-1) at pH 7.5, kobs = 2.4 (h-1) at pH 9.0",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "30"
},
"244": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "ACGGCGAGTTTCATGGAGTGATTGGGAGGTTAGCTCTA",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 38,
"linkage": "2',5'",
"main_article_first_author": "T K Prior",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "D R Semlow, A Flynn-Charlebois, I Rashid",
"main_article_pub_date": "2004",
"main_article_title": "Structure-function correlations derived from faster variants of a RNA ligase deoxyribozyme.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "7Z81",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 2.65 (h-1) at pH 7.5, kobs = 0.60 (min-1) at pH 9.0",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "35-38"
},
"245": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "ACGGGGCCGGTTTGCGTGCCTGATTGGGAGGTTAGCTCTA",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "T K Prior",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "D R Semlow, A Flynn-Charlebois, I Rashid",
"main_article_pub_date": "2004",
"main_article_title": "Structure-function correlations derived from faster variants of a RNA ligase deoxyribozyme.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "7Z48",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 2.13 (h-1) at pH 7.5, kobs = 0.52 (min-1) at pH 9.0",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "37"
},
"246": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CCCGAGGAGGGGCGGGGGGACTTGGTGTGGAGTTTCATTC",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "T K Prior",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "D R Semlow, A Flynn-Charlebois, I Rashid",
"main_article_pub_date": "2004",
"main_article_title": "Structure-function correlations derived from faster variants of a RNA ligase deoxyribozyme.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "7Z101",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.20 (h-1) at pH 7.5, kobs = 0.033 (min-1) at pH 9.0",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "45-50"
},
"247": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CTTTACGGTAGGGTGCCTGTGATAATGATCAGGGGACGGC",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "A Flynn-Charlebois",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Wang, T K Prior, I Rashid, K A Hoadley, R L Coppins, A C Wolf",
"main_article_pub_date": "2003",
"main_article_title": "Deoxyribozymes with 2'-5' RNA ligase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "9A12",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.39 (h-1) at pH 7.5, kobs = 0.065 (min-1) at pH 9.0",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "40-60"
},
"248": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "AAGGGGAGGGCCGATTGGCATTATCGGCGTCTTAGCTCTA",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "A Flynn-Charlebois",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Wang, T K Prior, I Rashid, K A Hoadley, R L Coppins, A C Wolf",
"main_article_pub_date": "2003",
"main_article_title": "Deoxyribozymes with 2'-5' RNA ligase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "9A5",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.76 (h-1) at pH 7.5, kobs = 0.18 (min-1) at pH 9.0",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "40-60"
},
"249": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "TAACCGTGGTTACCGTAAGCGCGGGGCTTATAGGGGATT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 39,
"linkage": "2',5'",
"main_article_first_author": "A Flynn-Charlebois",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Wang, T K Prior, I Rashid, K A Hoadley, R L Coppins, A C Wolf",
"main_article_pub_date": "2003",
"main_article_title": "Deoxyribozymes with 2'-5' RNA ligase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "9A6",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.17 (h-1) at pH 7.5, kobs = 0.040 (min-1) at pH 9.0",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "40-60"
},
"250": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "TGCGTTCTGATGAATTGCACATAGCTTATAGTTCCTTGCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "A Flynn-Charlebois",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Wang, T K Prior, I Rashid, K A Hoadley, R L Coppins, A C Wolf",
"main_article_pub_date": "2003",
"main_article_title": "Deoxyribozymes with 2'-5' RNA ligase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "9A2",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.08 (h-1) at pH 7.5, kobs = 0.023 (min-1) at pH 9.0",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "40-60"
},
"251": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2",
"e": "AATGAGGCTTGGCAGGGATTTAGTATTTTAACACTCCCGG",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUX",
"length": 40,
"linkage": "A15",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2003",
"main_article_title": "Deoxyribozymes that synthesize branched and lariat RNA.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "9F7",
"notes": "LARIAT FORMATION",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.27 (min-1) at pH 7.5",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": null,
"structures": [],
"x": "A, C, dA, dC",
"yield": ">85"
},
"252": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2",
"e": "AATGATGCTTGACAGGGTCTATAGTTTCTATGTAGCCCGA",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUX",
"length": 40,
"linkage": "A15",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2003",
"main_article_title": "Deoxyribozymes that synthesize branched and lariat RNA.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "9F21",
"notes": "LARIAT FORMATION",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.13 (min-1) at pH 7.5",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "A, C, dA, dC",
"yield": ">85"
},
"253": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2",
"e": "AGGATGTGGGGTTTTGCCCGAGGGTATGGCAGTGGGGA",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUX",
"length": 38,
"linkage": "U14",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2003",
"main_article_title": "Deoxyribozymes that synthesize branched and lariat RNA.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "9F13",
"notes": "LARIAT FORMATION",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 2.2 (min-1) at pH 7.5",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "A, C, dA, dC",
"yield": ">85"
},
"254": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2",
"e": "GGGATGTGGGGCGCCACCAAGTTAATGTTTGGTTTGGGGA",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUX",
"length": 40,
"linkage": "U14",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2003",
"main_article_title": "Deoxyribozymes that synthesize branched and lariat RNA.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "9F18",
"notes": "LARIAT FORMATION",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.81 (min-1) at pH 7.5",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "A, C, dA, dC",
"yield": ">85"
},
"255": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "GGATCATACGGTCGGAGGGGTTTGCCGTGAACATTCTTCA",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "W E Purtha",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "R L Coppins, M K Smalley",
"main_article_pub_date": "2005",
"main_article_title": "General deoxyribozyme-catalyzed synthesis of native 3'-5' RNA linkages.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "9DB1",
"notes": "",
"r": "GAUGUUCUAGCGCCGGA",
"rate_constant": "kobs = 0.2 (h-1) at pH 7.5, kobs = 0.036 (min-1) at pH 9.0",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": null,
"structures": [],
"x": null,
"yield": "60-70"
},
"256": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "GGATCATACGGTCGGAGGGGTTTGCCGTTTA",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUA",
"length": 31,
"linkage": "3',5'",
"main_article_first_author": "F Wachowius",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "F Javadi-Zarnaghi",
"main_article_pub_date": "2010",
"main_article_title": "Combinatorial mutation interference analysis reveals functional nucleotides required for DNA catalysis.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "9DB1*",
"notes": "",
"r": "GAUGUUCUAGCGCCGGA",
"rate_constant": "kobs = 0.016 (min-1) at pH 9.0",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": null,
"structures": [
"5CKI",
"5CKK"
],
"x": null,
"yield": "60-70"
},
"257": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "GTAGGGTTGGTAGACCAGGTTGAGCCGGCGTCCTTGTTTA",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "W E Purtha",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "R L Coppins, M K Smalley",
"main_article_pub_date": "2005",
"main_article_title": "General deoxyribozyme-catalyzed synthesis of native 3'-5' RNA linkages.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "7DE5",
"notes": "",
"r": "GAUGUUCUAGCGCCGGA",
"rate_constant": "kobs = 0.02 (min-1) at pH 7.5",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "40-50"
},
"258": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "GTGAGAGCCATTGTGCATTGTGGTGCAACTGTACGCGCCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "7CX2",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"259": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "GTGAGAGCAGGTTTGGCACGCGTGCCACTAACCCGCGCCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "7CX3",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"260": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "GTGGGAGCCTGATGGAAGAATGGGAGAACAGCACGCGCCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "7CX4",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.012 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "45-60"
},
"261": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "GGGAGAGCTAGGAGGCGCTGAGTCTCGGCTCCTCGCGCCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "7CX5",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"262": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "GTGAGAGCAAGCGAGGGATACATGAACCGAAACCGCGCCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "7CX6",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.03 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "45-60"
},
"263": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "GTGAGAGCAGTAAACGGAAGGCCTCTTCCTGTCCGCGCCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "7CX7",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"264": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "GTGAGAGCATGTGGCACCCTGGCAGGAACCTAACGCGCCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "7CX8",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.01 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "45-60"
},
"265": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "ACTGAGAGCCTCGATGAATGCCTAATTATATCGTCGCGCC",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "7CX9",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"266": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "GTGAGAGCAATACGTATGAAGATATTGAAGTTTCGCGCCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "7CX10",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"267": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "GTGAGAGCATCACTGTAACCGCCGTGCGGTGGACGCGCCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "7CX12",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"268": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "GGGAGAGCAGTTATGATGCATGAGCCATTGACCGCGCCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 39,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "7CX13",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"269": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "GGGAGAGCAGCGATGCAAGACATTGGGGCGGAGCCGCGCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "7CX14",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"270": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "TGAGAGCATTTCCGGCGGAGCTCTACGGGGGCCGCGCCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 39,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "7CX21",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"271": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "TTTAGTCAGGAGTAGACATCGATGATTGCTAATCGAACCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "n",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "7CX11",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"272": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "GTGAGAGAACCGCGGTGTAGACACAGATCGCGGCGCGCCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "8CW1",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"273": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "TACAAGGTGGGAGGAGGGAGCACCGATGCGGCATATCGTG",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "8CW8",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"274": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "GGGAGAGCAGTTATGACGCATAAGCTATTGACCGCGCCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 39,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "8CW11",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"275": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "GTGAGAGCAATCACTTTGGGTAGGTACGGGTGAACGCGCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "8CW15",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"276": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "GTTAGAGCCAAACACGTTTGTGTCAGCGGGTTTCGCGCCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "8CW16",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"277": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "GGAAGAGCAATGTACTCCGACGTCAGAGGATATCGCGCCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "8CW20",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"278": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "ACGCCCACCATTTAAGAGCATCGCCGGAATAGCGGGGACT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "n",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "8CW3",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"279": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "GCACGGCCGGATTGGGGGGCCCAATGACTTGATCATTGCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "n",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "8CW4",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"280": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "ACACGCGTTACGGACTGAGCAGATTCAGGCCAAACTGCCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "n",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "8CW9",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"281": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "ACATGTGCGGTAATGAGGCGTAGACAAATAGAGATACCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "n",
"l": "UAAUACGACUCACUAUA",
"length": 39,
"linkage": "2',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "8CW12",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"282": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "GGGGAAGACAAGATAGTCGAGGGGGACGCGCTCTCAGCCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "n",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "8CW13",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"283": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "GCGGGGTTAAGCCACGAATGCGGGGCAAAGCGTACCCCCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "n",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "8CW14",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"284": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "CAGCGCGATTGAGTGCGTGATTGAAGCTCGGGGTTGGTTA",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "K A Hoadley",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "W E Purtha, A C Wolf, A Flynn-Charlebois",
"main_article_pub_date": "2005",
"main_article_title": "Zn2+-dependent deoxyribozymes that form natural and unnatural RNA linkages.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "12BB5",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.020/0.013 min-1 for R substrates with 5'-dG and G, respectively.",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "35/17 for R substrates with 5'-dG and G, respectively."
},
"285": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "CAGAGCCCCTTACGTACAGCCTTTTTAGGTAACCGGGGAG",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "K A Hoadley",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "W E Purtha, A C Wolf, A Flynn-Charlebois",
"main_article_pub_date": "2005",
"main_article_title": "Zn2+-dependent deoxyribozymes that form natural and unnatural RNA linkages.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "12BB12",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.011/0.0039 min-1 for R substrates with 5'-dG and G, respectively.",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "30/12 for R substrates with 5'-dG and G, respectively."
},
"286": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "CAGCGCGATTGGGGGCGTGATTGAAGCTCGGGGTTGGTTA",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "n",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "12BB24",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"287": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "ACTATACCACCGAGATTCGAATTGGAGCAGTAGTGGCTTG",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "n",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "12BB26",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"288": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "TGTAGCCTTCTGAAGGTTGGCTGGTTCGGCGAGGTGGGAA",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "n",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "12BB33",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"289": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "ACCGGTCCCTGTCGGTCGAAGGAGTGGCACTGAGGAGAAT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "n",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "12BB36",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"290": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "ACGCGAGGGGAGTTCAATCGCTTGTTCGGCAAGGTCGGGA",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "n",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "12BB41",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"291": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "CCGCTCCGATTGGTGGAGTCTATTGGGGCCTGTAGGCGAG",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "K A Hoadley",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "W E Purtha, A C Wolf, A Flynn-Charlebois",
"main_article_pub_date": "2005",
"main_article_title": "Zn2+-dependent deoxyribozymes that form natural and unnatural RNA linkages.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "12BB1",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.056/0.060 min-1 for R substrates with 5'-dG and G, respectively.",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "20/5 for R substrates with 5'-dG and G, respectively."
},
"292": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "ACCGCGGGAGCTACGTTAGTGGTAACTGCTTGTAGGCGAG",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "K A Hoadley",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "W E Purtha, A C Wolf, A Flynn-Charlebois",
"main_article_pub_date": "2005",
"main_article_title": "Zn2+-dependent deoxyribozymes that form natural and unnatural RNA linkages.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "12BB2",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.077/0.060 min-1 for R substrates with 5'-dG and G, respectively.",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "15/5 for R substrates with 5'-dG and G, respectively."
},
"293": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "AAGGCAGCAGGCGGCATTTTTTGTCCGTACGTTCTCCTATA",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "n",
"l": "UAAUACGACUCACUAUA",
"length": 41,
"linkage": "2',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "12BB21",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"294": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "ACCGCGGGAGTTTCGTTAGTGGTGACTGCTTGTAGGCGAG",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "n",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "12BB22",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"295": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "GTAGAGTGGTTCCGGTTATCGCCTTAGATACCATTGCTGT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "n",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "12BB25",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"296": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "CCGCTCCGATTGGTGAAGTCTATTGGGGCCTGTAGGCGAG",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "n",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "12BB27",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"297": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "CCGCTGCGGAGGTTGTACGCGTCTGTGGCTTGTAGGCGAG",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "n",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "12BB38",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"298": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "TACACCTATTATGGTTTCGTGAGGGGTGTGGCTGGTGCTG",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "*",
"main_article_first_author": "K A Hoadley",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "W E Purtha, A C Wolf, A Flynn-Charlebois",
"main_article_pub_date": "2005",
"main_article_title": "Zn2+-dependent deoxyribozymes that form natural and unnatural RNA linkages.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "12BB6",
"notes": "2',3'-branch or 2',2'-branch",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.065/0.046 min-1 for R substrates with 5'-dG and G, respectively.",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "unnatural",
"s": "",
"structures": [],
"x": "",
"yield": "35/40 for R substrates with 5'-dG and G, respectively."
},
"299": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "CACGCTGACTAGCTTCGTGAGGGGGTGTGATAGATGCGG",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 39,
"linkage": "*",
"main_article_first_author": "K A Hoadley",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "W E Purtha, A C Wolf, A Flynn-Charlebois",
"main_article_pub_date": "2005",
"main_article_title": "Zn2+-dependent deoxyribozymes that form natural and unnatural RNA linkages.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "12BB8",
"notes": "2',3'-branch or 2',2'-branch",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.0107/0.056 min-1 for R substrates with 5'-dG and G, respectively.",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "unnatural",
"s": "",
"structures": [],
"x": "",
"yield": "Approx. 35 for R substrates with 5'-dG and G."
},
"300": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "TACACCTATAATGGTTTCGTGAGGGGTGTGGCTGATGCTG",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "n",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "*",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "12BB23",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "unnatural",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"301": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "CCTGTACTGCGCTGCTCAAATCAGCCGGGTGTGTGAACTC",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "n",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "*",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "12BB30",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "unnatural",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"302": {
"buffer": "70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "TGTATGTGGGGGGTGTGTATCAGTCTACTGTGGCTTAAGC",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "n",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "*",
"main_article_first_author": "D M Kost",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J P Gerdt, P I Pradeepkumar",
"main_article_pub_date": "2008",
"main_article_title": "Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "12BB32",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "unnatural",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"303": {
"buffer": "70 mM Tris pH 7.9, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "AGGGAGCGGTGTGGCACAGACAGGGTATTAACTCTGTGAG",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "*",
"main_article_first_author": "K A Hoadley",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "W E Purtha, A C Wolf, A Flynn-Charlebois",
"main_article_pub_date": "2005",
"main_article_title": "Zn2+-dependent deoxyribozymes that form natural and unnatural RNA linkages.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "6J12",
"notes": "3'-2' or 2'-2' linear junctions",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.5 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "unnatural",
"s": "",
"structures": [],
"x": "",
"yield": "50"
},
"304": {
"buffer": "70 mM Tris pH 7.9, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "GTGGGAGGACGCGTCAGTAGTTATGACCTGCCTGAGTGCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "*",
"main_article_first_author": "K A Hoadley",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "W E Purtha, A C Wolf, A Flynn-Charlebois",
"main_article_pub_date": "2005",
"main_article_title": "Zn2+-dependent deoxyribozymes that form natural and unnatural RNA linkages.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "6J1",
"notes": "same as 6J12",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.044 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "unnatural",
"s": "",
"structures": [],
"x": "",
"yield": "60"
},
"305": {
"buffer": "70 mM Tris pH 7.9, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "CGGGAGAGGAGTGGCAGAGATACTGTGAATGTAATCTGAG",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "*",
"main_article_first_author": "K A Hoadley",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "W E Purtha, A C Wolf, A Flynn-Charlebois",
"main_article_pub_date": "2005",
"main_article_title": "Zn2+-dependent deoxyribozymes that form natural and unnatural RNA linkages.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "6J18",
"notes": "same as 6J12",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.061 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "unnatural",
"s": "",
"structures": [],
"x": "",
"yield": "45"
},
"306": {
"buffer": "70 mM Tris pH 7.9, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2",
"e": "TGCACGGGGGGTGAGGTTTCCGCCGTTGAAACGTAGCACG",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "*",
"main_article_first_author": "K A Hoadley",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "W E Purtha, A C Wolf, A Flynn-Charlebois",
"main_article_pub_date": "2005",
"main_article_title": "Zn2+-dependent deoxyribozymes that form natural and unnatural RNA linkages.",
"metal_ions": [
"Zn2+"
],
"n": "40",
"name": "6J2",
"notes": "3'-2' or 2'-2' linear junctions (whichever is not formed by 6J12)",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.018 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "unnatural",
"s": "",
"structures": [],
"x": "",
"yield": "15"
},
"307": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CAGTGCAGGGCGTGAGGGCTCGGTTCCCGTATTATCT",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 37,
"linkage": "A8",
"main_article_first_author": "R L Coppins",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2004",
"main_article_title": "A DNA enzyme that mimics the first step of RNA splicing.",
"metal_ions": [
"Mg2+"
],
"n": "37",
"name": "7S11",
"notes": "LARIAT FORMATION",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.5 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ">90"
},
"308": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CAGCGCAGGGTGTGAGGGCTCGGTTCCCGTATTATTT",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 37,
"linkage": "A8",
"main_article_first_author": "R L Coppins",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2004",
"main_article_title": "A DNA enzyme that mimics the first step of RNA splicing.",
"metal_ions": [
"Mg2+"
],
"n": "37",
"name": "7S10",
"notes": "LARIAT FORMATION",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"309": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2",
"e": "GGCACTCAGAGCGCACGGCG",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUAUCG",
"length": 20,
"linkage": "U16",
"main_article_first_author": "E D Pratico",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Wang",
"main_article_pub_date": "2005",
"main_article_title": "A deoxyribozyme that synthesizes 2',5'-branched RNA with any branch-site nucleotide.",
"metal_ions": [
"Mn2+"
],
"n": "20",
"name": "6CE8",
"notes": "",
"r": "GAAUGUUCUAGCGCGGA",
"rate_constant": "kobs = 0.67 h-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": "90"
},
"310": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CCCGACGATGGAATGGAAGGGCGGGAGAGCCGCGGTAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 38,
"linkage": "3',5'",
"main_article_first_author": "R L Coppins",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2004",
"main_article_title": "Rational modification of a selection strategy leads to deoxyribozymes that create native 3'-5' RNA linkages.",
"metal_ions": [
"Mg2+"
],
"n": "38",
"name": "8AY1",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"311": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CAGCCTACGGGTAACAAGGTGCGAGAGATCAGCGGCAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 38,
"linkage": "3',5'",
"main_article_first_author": "R L Coppins",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2004",
"main_article_title": "Rational modification of a selection strategy leads to deoxyribozymes that create native 3'-5' RNA linkages.",
"metal_ions": [
"Mg2+"
],
"n": "38",
"name": "8AY3",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"312": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CACGAGATGTTTACCACGCTGCGGGAGATTAGCGGTAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 38,
"linkage": "3',5'",
"main_article_first_author": "R L Coppins",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2004",
"main_article_title": "Rational modification of a selection strategy leads to deoxyribozymes that create native 3'-5' RNA linkages.",
"metal_ions": [
"Mg2+"
],
"n": "38",
"name": "8AY9",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"313": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CACAAGGGAACAGGCTGCGTGTGAGAGAGTCGCGGTAA",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 38,
"linkage": "3',5'",
"main_article_first_author": "R L Coppins",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2004",
"main_article_title": "Rational modification of a selection strategy leads to deoxyribozymes that create native 3'-5' RNA linkages.",
"metal_ions": [
"Mg2+"
],
"n": "38",
"name": "8AY11",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"314": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CAGGTCGTTAGGCGGGAGATAACAAGGTGAAGCGGTAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 38,
"linkage": "3',5'",
"main_article_first_author": "R L Coppins",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2004",
"main_article_title": "Rational modification of a selection strategy leads to deoxyribozymes that create native 3'-5' RNA linkages.",
"metal_ions": [
"Mg2+"
],
"n": "38",
"name": "8AY13",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.0077 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "40"
},
"315": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CACGGCAACAGCAACAGCAGTGCGAGAGAGACGCGGTAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 39,
"linkage": "3',5'",
"main_article_first_author": "R L Coppins",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2004",
"main_article_title": "Rational modification of a selection strategy leads to deoxyribozymes that create native 3'-5' RNA linkages.",
"metal_ions": [
"Mg2+"
],
"n": "38",
"name": "8AY17",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"316": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 150 mM NaCl, 2 mM KCl",
"e": "GACGCCACCGAAGTCGCCATCTCCCGTAGGTGAAGGGCGTGAGGGTTCCA",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAUAAUACGACUCACUGCG",
"length": 50,
"linkage": "A11",
"main_article_first_author": "C S Lee",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T P Mui",
"main_article_pub_date": "2011",
"main_article_title": "Improved deoxyribozymes for synthesis of covalently branched DNA and RNA.",
"metal_ions": [
"Mn2+"
],
"n": "*",
"name": "8LX1",
"notes": "Pool N33-CGCAGTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": null,
"structures": [],
"x": null,
"yield": ""
},
"317": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 150 mM NaCl, 2 mM KCl",
"e": "CCCACCGGTAGGGCTACGGGCAAGGTCAACATGCCGCAAGTGAGGGGTCGA",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAUAAUACGACUCACUGCG",
"length": 51,
"linkage": "A11",
"main_article_first_author": "C S Lee",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T P Mui",
"main_article_pub_date": "2011",
"main_article_title": "Improved deoxyribozymes for synthesis of covalently branched DNA and RNA.",
"metal_ions": [
"Mn2+"
],
"n": "*",
"name": "8LX3",
"notes": "Pool N33-CGCAGTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"318": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 150 mM NaCl, 2 mM KCl",
"e": "CAGGCCATGGATTATTGGAGGAATGGGCCGTCAGCGCGTGAGGTGTGGA",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAUAAUACGACUCACUGCG",
"length": 49,
"linkage": "A11",
"main_article_first_author": "C S Lee",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T P Mui",
"main_article_pub_date": "2011",
"main_article_title": "Improved deoxyribozymes for synthesis of covalently branched DNA and RNA.",
"metal_ions": [
"Mn2+"
],
"n": "*",
"name": "8LX5",
"notes": "Pool N33-CGCAGTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"319": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 150 mM NaCl, 2 mM KCl",
"e": "CAGTGCAGGGCGTGAGGGCTCCATCCCCAGTGCAGGGCGTGAGGGCTCGG",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAUAAUACGACUCACUGCG",
"length": 50,
"linkage": "A11",
"main_article_first_author": "C S Lee",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T P Mui",
"main_article_pub_date": "2011",
"main_article_title": "Improved deoxyribozymes for synthesis of covalently branched DNA and RNA.",
"metal_ions": [
"Mn2+"
],
"n": "*",
"name": "8LX6",
"notes": "Pool N33-CGCAGTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.29 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": "75"
},
"320": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 150 mM NaCl, 2 mM KCl",
"e": "CCGACGAGGTGAGGGGCATGCGGTACACGCGCATATAGTGAGGGGTCCA",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAUAAUACGACUCACUGCG",
"length": 49,
"linkage": "A11",
"main_article_first_author": "C S Lee",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T P Mui",
"main_article_pub_date": "2011",
"main_article_title": "Improved deoxyribozymes for synthesis of covalently branched DNA and RNA.",
"metal_ions": [
"Mn2+"
],
"n": "*",
"name": "8LX8",
"notes": "Pool N33-CGCAGTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"321": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 150 mM NaCl, 2 mM KCl",
"e": "CCCCGAGGTGTGGACATAGCGGGCTGGTGTGGCGCGCAGTGAGCCTAGTG",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAUAAUACGACUCACUGCG",
"length": 50,
"linkage": "A11",
"main_article_first_author": "C S Lee",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T P Mui",
"main_article_pub_date": "2011",
"main_article_title": "Improved deoxyribozymes for synthesis of covalently branched DNA and RNA.",
"metal_ions": [
"Mn2+"
],
"n": "*",
"name": "8LX12",
"notes": "Pool N33-CGCAGTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"322": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 150 mM NaCl, 2 mM KCl",
"e": "CATCGGTGTAGCGATGCACGGGCAAAGATACATTCGCAGTGAGGGTGCGG",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAUAAUACGACUCACUGCG",
"length": 50,
"linkage": "A11",
"main_article_first_author": "C S Lee",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T P Mui",
"main_article_pub_date": "2011",
"main_article_title": "Improved deoxyribozymes for synthesis of covalently branched DNA and RNA.",
"metal_ions": [
"Mn2+"
],
"n": "*",
"name": "8LX13",
"notes": "Pool N33-CGCAGTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"323": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 150 mM NaCl, 2 mM KCl",
"e": "CCACGTGCGAGGTTAGACGTCAGTGGCTGGTGTTCGCAGTGAGCCTATTG",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAUAAUACGACUCACUGCG",
"length": 50,
"linkage": "A11",
"main_article_first_author": "C S Lee",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T P Mui",
"main_article_pub_date": "2011",
"main_article_title": "Improved deoxyribozymes for synthesis of covalently branched DNA and RNA.",
"metal_ions": [
"Mn2+"
],
"n": "*",
"name": "8LX14",
"notes": "Pool N33-CGCAGTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"324": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 150 mM NaCl, 2 mM KCl",
"e": "CCGACGCGTCCAGGAGGCAAGGGCTATATGCACCGCAGTGAGGGCTCGG",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAUAAUACGACUCACUGCG",
"length": 49,
"linkage": "A11",
"main_article_first_author": "C S Lee",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T P Mui",
"main_article_pub_date": "2011",
"main_article_title": "Improved deoxyribozymes for synthesis of covalently branched DNA and RNA.",
"metal_ions": [
"Mn2+"
],
"n": "*",
"name": "8LX15",
"notes": "Pool N33-CGCAGTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"325": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 150 mM NaCl, 2 mM KCl",
"e": "CACGAGGTAGGGAGGGGCACACTGCTATGCTCAGCGCAGTGAGAGTATGC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAUAAUACGACUCACUGCG",
"length": 50,
"linkage": "A11",
"main_article_first_author": "C S Lee",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T P Mui",
"main_article_pub_date": "2011",
"main_article_title": "Improved deoxyribozymes for synthesis of covalently branched DNA and RNA.",
"metal_ions": [
"Mn2+"
],
"n": "*",
"name": "8LX16",
"notes": "Pool N33-CGCAGTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"326": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 150 mM NaCl, 2 mM KCl",
"e": "CACATGTCTAGCGGCGTGCGGGAGAAGTGCAAGCGCTGTGAGGGTGTG",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAUAAUACGACUCACUGCG",
"length": 48,
"linkage": "A11",
"main_article_first_author": "C S Lee",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T P Mui",
"main_article_pub_date": "2011",
"main_article_title": "Improved deoxyribozymes for synthesis of covalently branched DNA and RNA.",
"metal_ions": [
"Mn2+"
],
"n": "*",
"name": "8LX17",
"notes": "Pool N33-CGCAGTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"327": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 150 mM NaCl, 2 mM KCl",
"e": "CCAAGGCAGAGCGTAGCCAGACAGCCGGGAGGTTCGCAGTGAGTGAATGG",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAUAAUACGACUCACUGCG",
"length": 50,
"linkage": "A11",
"main_article_first_author": "C S Lee",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T P Mui",
"main_article_pub_date": "2011",
"main_article_title": "Improved deoxyribozymes for synthesis of covalently branched DNA and RNA.",
"metal_ions": [
"Mn2+"
],
"n": "*",
"name": "8LX18",
"notes": "Pool N33-CGCAGTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"328": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 150 mM NaCl, 2 mM KCl",
"e": "GTAGCCACATTAGTGCGCTGCAACTGCTATGCAACGCAGTGAGAGGGTGC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAUAAUACGACUCACUGCG",
"length": 50,
"linkage": "A11",
"main_article_first_author": "C S Lee",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T P Mui",
"main_article_pub_date": "2011",
"main_article_title": "Improved deoxyribozymes for synthesis of covalently branched DNA and RNA.",
"metal_ions": [
"Mn2+"
],
"n": "*",
"name": "8LX21",
"notes": "Pool N33-CGCAGTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"341": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CTAACCATTATCCTCGATTGTTAGAGCGAACAGCTGCAACGGGTTGATTATAGTGAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 57,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-18",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "kcat = 0.030 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"342": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CTAACCACTATCCATGATTGTAAGAGCGGACAGCTGCAACGGGTTGATTATAGTGGGG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 58,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-13",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"343": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CTAACCATTATCCTCGATTGTTAGAACGAACAGTTGCAACGGGTTGATTATAGTGGG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 57,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-9",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"344": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "TAACCCATTATCTTCGATGTTAGAACGAACAGCTGCAACGGGTTGATTATAGTGAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 56,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-19",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"345": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CTCGCCATTATCCTTGAGTGTTAGAACGAACAGTTGCAACGGGTTGATTATAGTGAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 57,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-15",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"346": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CTATGCATTATCCTTGACTGTTAGATCGAGCAGTTGCAACGGGTTGATTATAGTGAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 57,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-7",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"347": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CTAACCATTATCCCTGATTGTTAGAACGAACAGTTGCGACGGGTTGATTATAGTGAC",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 57,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-22",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"348": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CTACGCATTATCCCTGGTTGTTAGAACGAGCAGTTGCAACGGGTTGATTATAGTGAC",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 57,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-6",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"349": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CAAACCATTATCCTCGATTGCAAGAACGAGCAGTTGGAACGGGTTGATTGTAGTGAGG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 58,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-21",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"350": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CATATTCATCATCCTCGACTGCAAGAAAGAACAGTTGGAACGGGTTGAATATAGTGAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 58,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-3",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"351": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CTCCTCATTATTCACGAATGATAGCACGAATAGTGTGAACGGGTTGATTATAGTGGCG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 58,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-5",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"352": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CTCCTCATTATTCTAGAATGATAGCACGAATAGTGTGAACGGGTTGATTATAGTGGCG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 58,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-17",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"353": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CAGCTCATTATTCACGAATGATGCACGAATAGTGTGAACGGGTTGATTATAGTGGG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 56,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-4",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"354": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "AACCCTCATTATCCACCAATGATAGCACGAATAGTGTGAGCGGGTTGATTATAGTGAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 58,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-12",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"355": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CTACCCATTATTCACGAATGATAGCACGAATAGTGTGAACGGGTTGATTATAGTGAC",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 57,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-20",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"356": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "AGGACTCATTAAGCTCGATTGCTCGAACGAACGGTTGGCACGGGTTGATTATAGTG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 56,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-14",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"357": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CGCAGCATTATGCTCGCATGCCCGAACGAACGGTTGGCACGGGTTGATTATAGTGGG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 57,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-8",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"358": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CGACTGGTTTTGCTCGTTTCTTCGTAGGAACAGATGTAATGGGTTGATATAGTGGCG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 57,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-2",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"359": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CGACTGGCTCTGCTCGTTTCTTCGAATGAACAGATGTAGTGGGTTGATATAGCGCG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 56,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-10",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"360": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CGACTAATCATGCTCGAATGTTCGTAAGAACAGTCTGTGCGGGTGGAATATAGTGAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 57,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-16",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"361": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "ACTGACTCATACTGCACGCTTGTCCCTAAGGTAGTTGCGCAGGTGGAATATAGTGGG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 57,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-1",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"362": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CTACGGGTTATGGTTGATTATACGTAAAAACAGTTAGGATGAGTTGTTGGTCGTGG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 56,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-11",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"364": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CCGTAGGTGAAGGGCGTGAGGGTTCCATTCC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAUAAUACGUCUCAC",
"length": 31,
"linkage": "A8",
"main_article_first_author": "E Zelin",
"main_article_last_autor": "Scott K Silverman",
"main_article_mid_authors": "Yangming Wang",
"main_article_pub_date": "2006",
"main_article_title": "Adenosine is inherently favored as the branch-site RNA nucleotide in a structural context that resembles natural RNA splicing.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10DM24",
"notes": "Pool N15-GTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.26 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": null,
"structures": [],
"x": null,
"yield": ">85"
},
"365": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CGGTAAGGCCAGGGCGTGAGGGTCCGCTTCC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAUAAUACGUCUCAC",
"length": 31,
"linkage": "A8",
"main_article_first_author": "E Zelin",
"main_article_last_autor": "Scott K Silverman",
"main_article_mid_authors": "Yangming Wang",
"main_article_pub_date": "2006",
"main_article_title": "Adenosine is inherently favored as the branch-site RNA nucleotide in a structural context that resembles natural RNA splicing.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10DM3",
"notes": "Pool N15-GTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.18 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ">80"
},
"366": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CATTATGCGAAGGGCGTGAGGGTTCCGTTCC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAUAAUACGUCUCAC",
"length": 31,
"linkage": "A8",
"main_article_first_author": "E Zelin",
"main_article_last_autor": "Scott K Silverman",
"main_article_mid_authors": "Yangming Wang",
"main_article_pub_date": "2006",
"main_article_title": "Adenosine is inherently favored as the branch-site RNA nucleotide in a structural context that resembles natural RNA splicing.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10DM5",
"notes": "Pool N15-GTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.32 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": "75"
},
"367": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CCTGTGGCAAAGGGCGTGAGGGTACTGTTCC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAUAAUACGUCUCAC",
"length": 31,
"linkage": "A8",
"main_article_first_author": "E Zelin",
"main_article_last_autor": "Scott K Silverman",
"main_article_mid_authors": "Yangming Wang",
"main_article_pub_date": "2006",
"main_article_title": "Adenosine is inherently favored as the branch-site RNA nucleotide in a structural context that resembles natural RNA splicing.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10DM10",
"notes": "Pool N15-GTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.31 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": "80"
},
"368": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CCTATGGCCCAGGGCGTGAGGGTGCGGTTCC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAUAAUACGUCUCAC",
"length": 31,
"linkage": "A8",
"main_article_first_author": "E Zelin",
"main_article_last_autor": "Scott K Silverman",
"main_article_mid_authors": "Yangming Wang",
"main_article_pub_date": "2006",
"main_article_title": "Adenosine is inherently favored as the branch-site RNA nucleotide in a structural context that resembles natural RNA splicing.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10DM19",
"notes": "Pool N15-GTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.27 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ">80"
},
"369": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "AGTGTGCTGCTAGGGCGTGAGGGTCCGCTTCC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAUAAUACGUCUCAC",
"length": 32,
"linkage": "A8",
"main_article_first_author": "E Zelin",
"main_article_last_autor": "Scott K Silverman",
"main_article_mid_authors": "Yangming Wang",
"main_article_pub_date": "2006",
"main_article_title": "Adenosine is inherently favored as the branch-site RNA nucleotide in a structural context that resembles natural RNA splicing.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10DM21",
"notes": "Pool N15-GTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.19 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": "90"
},
"370": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CCGGCAGGCAAGGGTGTGAGGGCTCGGTTCC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAUAAUACGUCUCAC",
"length": 31,
"linkage": "A8",
"main_article_first_author": "E Zelin",
"main_article_last_autor": "Scott K Silverman",
"main_article_mid_authors": "Yangming Wang",
"main_article_pub_date": "2006",
"main_article_title": "Adenosine is inherently favored as the branch-site RNA nucleotide in a structural context that resembles natural RNA splicing.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "7DM3",
"notes": "Pool N15-GTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.11 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": "90"
},
"371": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CCGTAGGCAAAGGGCGTGAGGGCTCGGTTCC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAUAAUACGUCUCAC",
"length": 31,
"linkage": "A8",
"main_article_first_author": "E Zelin",
"main_article_last_autor": "Scott K Silverman",
"main_article_mid_authors": "Yangming Wang",
"main_article_pub_date": "2006",
"main_article_title": "Adenosine is inherently favored as the branch-site RNA nucleotide in a structural context that resembles natural RNA splicing.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "7DM11",
"notes": "Pool N15-GTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.13 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": "90"
},
"372": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CATTATGCCCAGGGCGTGAGGGTGCGGTTCC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAUAAUACGUCUCAC",
"length": 31,
"linkage": "A8",
"main_article_first_author": "E Zelin",
"main_article_last_autor": "Scott K Silverman",
"main_article_mid_authors": "Yangming Wang",
"main_article_pub_date": "2006",
"main_article_title": "Adenosine is inherently favored as the branch-site RNA nucleotide in a structural context that resembles natural RNA splicing.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "7DM12",
"notes": "Pool N15-GTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.15 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ">80"
},
"373": {
"buffer": "50 mM CHES pH 9.0, 40 mM MgCl2",
"e": "CTACAGGACCCGCGCAAAAGTGATTTCAGAGGTATGGGTG",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "D R Semlow",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Parallel selections in vitro reveal a preference for 2'-5' RNA ligation upon deoxyribozyme-mediated opening of a 2',3'-cyclic phosphate.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "8BG11",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.2-0.3 h-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "25-35"
},
"374": {
"buffer": "50 mM CHES pH 9.0, 40 mM MgCl2",
"e": "CTAACTGTCAGATTCATCTAAAGATGGGGGGTTGTTTGAC",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "D R Semlow",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Parallel selections in vitro reveal a preference for 2'-5' RNA ligation upon deoxyribozyme-mediated opening of a 2',3'-cyclic phosphate.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "8BG29",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.2-0.3 h-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "25-35"
},
"375": {
"buffer": "50 mM CHES pH 9.0, 40 mM MgCl2",
"e": "GGCGTTAAGGATTGGCGGAAACGGGTGGATCGCGGACC",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 38,
"linkage": "2',5'",
"main_article_first_author": "D R Semlow",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Parallel selections in vitro reveal a preference for 2'-5' RNA ligation upon deoxyribozyme-mediated opening of a 2',3'-cyclic phosphate.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "8BH6",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.2-0.3 h-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "25-35"
},
"376": {
"buffer": "50 mM CHES pH 9.0, 40 mM MgCl2",
"e": "AGGGACAAACCATAAGTCGCATCGGGTGGAACGTAGACC",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 39,
"linkage": "2',5'",
"main_article_first_author": "D R Semlow",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Parallel selections in vitro reveal a preference for 2'-5' RNA ligation upon deoxyribozyme-mediated opening of a 2',3'-cyclic phosphate.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "8BH41",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.2-0.3 h-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "25-35"
},
"377": {
"buffer": "50 mM CHES pH 9.0, 40 mM MgCl2",
"e": "GGCCGCTCACCCGTAGAACGGGTTGGATCCTAGGGGAC",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 38,
"linkage": "2',5'",
"main_article_first_author": "D R Semlow",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Parallel selections in vitro reveal a preference for 2'-5' RNA ligation upon deoxyribozyme-mediated opening of a 2',3'-cyclic phosphate.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "12BK15",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.2-0.3 h-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "25-35"
},
"378": {
"buffer": "50 mM CHES pH 9.0, 40 mM MgCl2",
"e": "GTCCAAGTGCAAAAGTCTTGAAGCCACTGCTAGGGCAC",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 38,
"linkage": "2',5'",
"main_article_first_author": "D R Semlow",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Parallel selections in vitro reveal a preference for 2'-5' RNA ligation upon deoxyribozyme-mediated opening of a 2',3'-cyclic phosphate.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "12BK21",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.2-0.3 h-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "25-35"
},
"379": {
"buffer": "50 mM CHES pH 9.0, 40 mM MgCl2",
"e": "GGACAATGGCACACAGTGTGGTCAGGAACTAGGTGATA",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 38,
"linkage": "2',5'",
"main_article_first_author": "D R Semlow",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Parallel selections in vitro reveal a preference for 2'-5' RNA ligation upon deoxyribozyme-mediated opening of a 2',3'-cyclic phosphate.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "12BK29",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.2-0.3 h-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "25-35"
},
"536": {
"buffer": "50 mm CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CAGCTATATGTGCTGGACTGAGAGGGGTAGTTTCGCAGTGAGGTGTAGG",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGATAATACGXTTCACTGCG",
"length": 49,
"linkage": "branch-site nucleotide X",
"main_article_first_author": "P I Pradeepkumar",
"main_article_last_autor": "Scott K Silverman",
"main_article_mid_authors": "Claudia H\u00f6bartner, Dana A Baum",
"main_article_pub_date": "2008",
"main_article_title": "DNA-catalyzed formation of nucleopeptide linkages.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "9HR17",
"notes": "Pool N33-CGCAGTGAG-N7, the deoxyribozyme's sequence is anotated with the 9-nt linker between the two initially randomized regions",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.0094 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "rA, rC",
"yield": "61"
},
"1124": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM alachlor, 10% methanol ",
"e": "GGAGACAGGTTCCGGATGCATG",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "9Q1",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1125": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM alachlor, 10% methanol ",
"e": "GGAGATAGGTTCCAGCTGATTG",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "9Q2",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1126": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM alachlor, 10% methanol ",
"e": "GGACCGATGGAGTGAACTATGC",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "9Q5",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1127": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM alachlor, 10% methanol ",
"e": "ACGGACAGTTTCCGGAGCCGTG",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "9Q9",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1128": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM atrazine, 10% methanol",
"e": "GGTACGGGGCGTGCGGAGGCAC",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "9R2a",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1129": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM atrazine, 10% methanol",
"e": "GGTTCGGGGTATGCGGAGGCAT",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "9R2b",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1130": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM atrazine, 10% methanol",
"e": "GGACCGATGGAGTGAACTATGC",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "9R4a",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1131": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM atrazine, 10% methanol",
"e": "GGACCATGTTGGAGCGGCCCAG",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "9R6",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1132": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM atrazine, 10% methanol",
"e": "GGACCATGGGGGAGCGGCCCGC",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "9R7",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1133": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM atrazine, 10% methanol",
"e": "GGAGGATCGGACAGCGTTATCG",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "9R16b",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1134": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM atrazine, 10% methanol",
"e": "GGAGCGACACACAGACCTGTTC",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "9R20",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "kobs = 0.133 h-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "70"
},
"1135": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM alachlor, 10% methanol ",
"e": "GGAGGATCGTACAGCGTTATCG",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "10Q7b",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1491": {
"buffer": "50 mM HEPES pH 7.5, 2 mM KCl, 150 mM NaCl, MgCl2, 20 mM MnCl2",
"e": "GCGGGCCCCAATTCATTGGCTTAACTACGAGGACGTCCAG",
"fg1s": [
"3 '- OH"
],
"fg2s": [
"5'-adenylated RNA"
],
"kinetics": "y",
"l": "GGCGAACUCUUCGA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "C P M Scheitl",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "S Lange",
"main_article_pub_date": "2020",
"main_article_title": "New Deoxyribozymes for the Native Ligation of RNA.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "SC8",
"notes": "",
"r": "GAGCUGAUCCUGAGAA",
"rate_constant": "kobs = 0.0092 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "70-80"
},
"1492": {
"buffer": "50 mM HEPES pH 7.5, 2 mM KCl, 150 mM NaCl, MgCl2, 20 mM MnCl2",
"e": "GTACGGACGTCAGTCACGAGGCAGCTGCTTTGCCAAACTG",
"fg1s": [
"3 '- OH"
],
"fg2s": [
"5'-adenylated RNA"
],
"kinetics": "y",
"l": "GGCGAACUCUUCGA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "C P M Scheitl",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "S Lange",
"main_article_pub_date": "2020",
"main_article_title": "New Deoxyribozymes for the Native Ligation of RNA.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "SC9",
"notes": "",
"r": "GAGCUGAUCCUGAGAA",
"rate_constant": "kobs = 0.0219 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "80-90"
},
"1493": {
"buffer": "50 mM HEPES pH 7.5, 2 mM KCl, 150 mM NaCl, MgCl2, 20 mM MnCl2",
"e": "ACCGTCACAAAAGACTGTAGTTAATACCACTGCAGGTCGT",
"fg1s": [
"3 '- OH"
],
"fg2s": [
"5'-adenylated RNA"
],
"kinetics": "y",
"l": "GGCGAACUCUUCGA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "C P M Scheitl",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "S Lange",
"main_article_pub_date": "2020",
"main_article_title": "New Deoxyribozymes for the Native Ligation of RNA.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "SC26",
"notes": "",
"r": "GAGCUGAUCCUGAGAA",
"rate_constant": "kobs = 0.0093 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "70"
},
"1494": {
"buffer": "50 mM HEPES pH 7.5, 2 mM KCl, 150 mM NaCl, MgCl2, 20 mM MnCl2",
"e": "GCACAGGGGTATAATTGCCTCGTACAACTTTATGTCCGAA",
"fg1s": [
"3 '- OH"
],
"fg2s": [
"5'-adenylated RNA"
],
"kinetics": "y",
"l": "GGCGAACUCUUCGA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "C P M Scheitl",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "S Lange",
"main_article_pub_date": "2020",
"main_article_title": "New Deoxyribozymes for the Native Ligation of RNA.",
"metal_ions": [
"Mn2+"
],
"n": "40",
"name": "SC34",
"notes": "",
"r": "GAGCUGAUCCUGAGAA",
"rate_constant": "kobs = 0.0193 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "80-90"
}
}