{
"240": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40mM MgCl2",
"e": "TTCGGTGGAGGTAAGCTCTG",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 20,
"linkage": "2',5'",
"main_article_first_author": "A Flynn-Charlebois",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T K Prior, K A Hoadley",
"main_article_pub_date": "2003",
"main_article_title": "In vitro evolution of an RNA-cleaving DNA enzyme into an RNA ligase switches the selectivity from 3'-5' to 2'-5'.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "7P4",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.42 (h-1)",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "15"
},
"241": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40mM MgCl2",
"e": "TTCTGCGCAGGTAAGCTGTA",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 20,
"linkage": "2',5'",
"main_article_first_author": "A Flynn-Charlebois",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T K Prior, K A Hoadley",
"main_article_pub_date": "2003",
"main_article_title": "In vitro evolution of an RNA-cleaving DNA enzyme into an RNA ligase switches the selectivity from 3'-5' to 2'-5'.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "7Q2",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.32 (h-1)",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "10-15"
},
"242": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40mM MgCl2",
"e": "TTTGTGGAGGTAAGCTCTG",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 19,
"linkage": "2',5'",
"main_article_first_author": "A Flynn-Charlebois",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T K Prior, K A Hoadley",
"main_article_pub_date": "2003",
"main_article_title": "In vitro evolution of an RNA-cleaving DNA enzyme into an RNA ligase switches the selectivity from 3'-5' to 2'-5'.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "7Q5",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 1.1 (h-1)",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "10"
},
"243": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40mM MgCl2",
"e": "TTACGTGGAGGTGGGCTCTA",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 20,
"linkage": "2',5'",
"main_article_first_author": "A Flynn-Charlebois",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T K Prior, K A Hoadley",
"main_article_pub_date": "2003",
"main_article_title": "In vitro evolution of an RNA-cleaving DNA enzyme into an RNA ligase switches the selectivity from 3'-5' to 2'-5'.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "7Q10",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.19 (h-1) at pH 7.5, kobs = 2.4 (h-1) at pH 9.0",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "30"
},
"244": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "ACGGCGAGTTTCATGGAGTGATTGGGAGGTTAGCTCTA",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 38,
"linkage": "2',5'",
"main_article_first_author": "T K Prior",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "D R Semlow, A Flynn-Charlebois, I Rashid",
"main_article_pub_date": "2004",
"main_article_title": "Structure-function correlations derived from faster variants of a RNA ligase deoxyribozyme.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "7Z81",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 2.65 (h-1) at pH 7.5, kobs = 0.60 (min-1) at pH 9.0",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "35-38"
},
"245": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "ACGGGGCCGGTTTGCGTGCCTGATTGGGAGGTTAGCTCTA",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "T K Prior",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "D R Semlow, A Flynn-Charlebois, I Rashid",
"main_article_pub_date": "2004",
"main_article_title": "Structure-function correlations derived from faster variants of a RNA ligase deoxyribozyme.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "7Z48",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 2.13 (h-1) at pH 7.5, kobs = 0.52 (min-1) at pH 9.0",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "37"
},
"246": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CCCGAGGAGGGGCGGGGGGACTTGGTGTGGAGTTTCATTC",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "T K Prior",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "D R Semlow, A Flynn-Charlebois, I Rashid",
"main_article_pub_date": "2004",
"main_article_title": "Structure-function correlations derived from faster variants of a RNA ligase deoxyribozyme.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "7Z101",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.20 (h-1) at pH 7.5, kobs = 0.033 (min-1) at pH 9.0",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "45-50"
},
"247": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CTTTACGGTAGGGTGCCTGTGATAATGATCAGGGGACGGC",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "A Flynn-Charlebois",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Wang, T K Prior, I Rashid, K A Hoadley, R L Coppins, A C Wolf",
"main_article_pub_date": "2003",
"main_article_title": "Deoxyribozymes with 2'-5' RNA ligase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "9A12",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.39 (h-1) at pH 7.5, kobs = 0.065 (min-1) at pH 9.0",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "40-60"
},
"248": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "AAGGGGAGGGCCGATTGGCATTATCGGCGTCTTAGCTCTA",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "A Flynn-Charlebois",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Wang, T K Prior, I Rashid, K A Hoadley, R L Coppins, A C Wolf",
"main_article_pub_date": "2003",
"main_article_title": "Deoxyribozymes with 2'-5' RNA ligase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "9A5",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.76 (h-1) at pH 7.5, kobs = 0.18 (min-1) at pH 9.0",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "40-60"
},
"249": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "TAACCGTGGTTACCGTAAGCGCGGGGCTTATAGGGGATT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 39,
"linkage": "2',5'",
"main_article_first_author": "A Flynn-Charlebois",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Wang, T K Prior, I Rashid, K A Hoadley, R L Coppins, A C Wolf",
"main_article_pub_date": "2003",
"main_article_title": "Deoxyribozymes with 2'-5' RNA ligase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "9A6",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.17 (h-1) at pH 7.5, kobs = 0.040 (min-1) at pH 9.0",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "40-60"
},
"250": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "TGCGTTCTGATGAATTGCACATAGCTTATAGTTCCTTGCT",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "A Flynn-Charlebois",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Wang, T K Prior, I Rashid, K A Hoadley, R L Coppins, A C Wolf",
"main_article_pub_date": "2003",
"main_article_title": "Deoxyribozymes with 2'-5' RNA ligase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "9A2",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.08 (h-1) at pH 7.5, kobs = 0.023 (min-1) at pH 9.0",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "40-60"
},
"251": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2",
"e": "AATGAGGCTTGGCAGGGATTTAGTATTTTAACACTCCCGG",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUX",
"length": 40,
"linkage": "A15",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2003",
"main_article_title": "Deoxyribozymes that synthesize branched and lariat RNA.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "9F7",
"notes": "LARIAT FORMATION",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.27 (min-1) at pH 7.5",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": null,
"structures": [],
"x": "A, C, dA, dC",
"yield": ">85"
},
"252": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2",
"e": "AATGATGCTTGACAGGGTCTATAGTTTCTATGTAGCCCGA",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUX",
"length": 40,
"linkage": "A15",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2003",
"main_article_title": "Deoxyribozymes that synthesize branched and lariat RNA.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "9F21",
"notes": "LARIAT FORMATION",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.13 (min-1) at pH 7.5",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "A, C, dA, dC",
"yield": ">85"
},
"253": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2",
"e": "AGGATGTGGGGTTTTGCCCGAGGGTATGGCAGTGGGGA",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUX",
"length": 38,
"linkage": "U14",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2003",
"main_article_title": "Deoxyribozymes that synthesize branched and lariat RNA.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "9F13",
"notes": "LARIAT FORMATION",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 2.2 (min-1) at pH 7.5",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "A, C, dA, dC",
"yield": ">85"
},
"254": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2",
"e": "GGGATGTGGGGCGCCACCAAGTTAATGTTTGGTTTGGGGA",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUX",
"length": 40,
"linkage": "U14",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2003",
"main_article_title": "Deoxyribozymes that synthesize branched and lariat RNA.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "9F18",
"notes": "LARIAT FORMATION",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.81 (min-1) at pH 7.5",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "A, C, dA, dC",
"yield": ">85"
},
"255": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "GGATCATACGGTCGGAGGGGTTTGCCGTGAACATTCTTCA",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUA",
"length": 40,
"linkage": "3',5'",
"main_article_first_author": "W E Purtha",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "R L Coppins, M K Smalley",
"main_article_pub_date": "2005",
"main_article_title": "General deoxyribozyme-catalyzed synthesis of native 3'-5' RNA linkages.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "9DB1",
"notes": "",
"r": "GAUGUUCUAGCGCCGGA",
"rate_constant": "kobs = 0.2 (h-1) at pH 7.5, kobs = 0.036 (min-1) at pH 9.0",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": null,
"structures": [],
"x": null,
"yield": "60-70"
},
"256": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "GGATCATACGGTCGGAGGGGTTTGCCGTTTA",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAAGUCUCAUGUACUA",
"length": 31,
"linkage": "3',5'",
"main_article_first_author": "F Wachowius",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "F Javadi-Zarnaghi",
"main_article_pub_date": "2010",
"main_article_title": "Combinatorial mutation interference analysis reveals functional nucleotides required for DNA catalysis.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "9DB1*",
"notes": "",
"r": "GAUGUUCUAGCGCCGGA",
"rate_constant": "kobs = 0.016 (min-1) at pH 9.0",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": null,
"structures": [
"5CKI",
"5CKK"
],
"x": null,
"yield": "60-70"
},
"307": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CAGTGCAGGGCGTGAGGGCTCGGTTCCCGTATTATCT",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 37,
"linkage": "A8",
"main_article_first_author": "R L Coppins",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2004",
"main_article_title": "A DNA enzyme that mimics the first step of RNA splicing.",
"metal_ions": [
"Mg2+"
],
"n": "37",
"name": "7S11",
"notes": "LARIAT FORMATION",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.5 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ">90"
},
"308": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CAGCGCAGGGTGTGAGGGCTCGGTTCCCGTATTATTT",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 37,
"linkage": "A8",
"main_article_first_author": "R L Coppins",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2004",
"main_article_title": "A DNA enzyme that mimics the first step of RNA splicing.",
"metal_ions": [
"Mg2+"
],
"n": "37",
"name": "7S10",
"notes": "LARIAT FORMATION",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"310": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CCCGACGATGGAATGGAAGGGCGGGAGAGCCGCGGTAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 38,
"linkage": "3',5'",
"main_article_first_author": "R L Coppins",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2004",
"main_article_title": "Rational modification of a selection strategy leads to deoxyribozymes that create native 3'-5' RNA linkages.",
"metal_ions": [
"Mg2+"
],
"n": "38",
"name": "8AY1",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"311": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CAGCCTACGGGTAACAAGGTGCGAGAGATCAGCGGCAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 38,
"linkage": "3',5'",
"main_article_first_author": "R L Coppins",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2004",
"main_article_title": "Rational modification of a selection strategy leads to deoxyribozymes that create native 3'-5' RNA linkages.",
"metal_ions": [
"Mg2+"
],
"n": "38",
"name": "8AY3",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"312": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CACGAGATGTTTACCACGCTGCGGGAGATTAGCGGTAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 38,
"linkage": "3',5'",
"main_article_first_author": "R L Coppins",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2004",
"main_article_title": "Rational modification of a selection strategy leads to deoxyribozymes that create native 3'-5' RNA linkages.",
"metal_ions": [
"Mg2+"
],
"n": "38",
"name": "8AY9",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"313": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CACAAGGGAACAGGCTGCGTGTGAGAGAGTCGCGGTAA",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 38,
"linkage": "3',5'",
"main_article_first_author": "R L Coppins",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2004",
"main_article_title": "Rational modification of a selection strategy leads to deoxyribozymes that create native 3'-5' RNA linkages.",
"metal_ions": [
"Mg2+"
],
"n": "38",
"name": "8AY11",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"314": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CAGGTCGTTAGGCGGGAGATAACAAGGTGAAGCGGTAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 38,
"linkage": "3',5'",
"main_article_first_author": "R L Coppins",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2004",
"main_article_title": "Rational modification of a selection strategy leads to deoxyribozymes that create native 3'-5' RNA linkages.",
"metal_ions": [
"Mg2+"
],
"n": "38",
"name": "8AY13",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.0077 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "40"
},
"315": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CACGGCAACAGCAACAGCAGTGCGAGAGAGACGCGGTAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 39,
"linkage": "3',5'",
"main_article_first_author": "R L Coppins",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2004",
"main_article_title": "Rational modification of a selection strategy leads to deoxyribozymes that create native 3'-5' RNA linkages.",
"metal_ions": [
"Mg2+"
],
"n": "38",
"name": "8AY17",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"341": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CTAACCATTATCCTCGATTGTTAGAGCGAACAGCTGCAACGGGTTGATTATAGTGAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 57,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-18",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "kcat = 0.030 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"342": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CTAACCACTATCCATGATTGTAAGAGCGGACAGCTGCAACGGGTTGATTATAGTGGGG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 58,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-13",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"343": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CTAACCATTATCCTCGATTGTTAGAACGAACAGTTGCAACGGGTTGATTATAGTGGG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 57,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-9",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"344": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "TAACCCATTATCTTCGATGTTAGAACGAACAGCTGCAACGGGTTGATTATAGTGAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 56,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-19",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"345": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CTCGCCATTATCCTTGAGTGTTAGAACGAACAGTTGCAACGGGTTGATTATAGTGAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 57,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-15",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"346": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CTATGCATTATCCTTGACTGTTAGATCGAGCAGTTGCAACGGGTTGATTATAGTGAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 57,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-7",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"347": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CTAACCATTATCCCTGATTGTTAGAACGAACAGTTGCGACGGGTTGATTATAGTGAC",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 57,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-22",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"348": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CTACGCATTATCCCTGGTTGTTAGAACGAGCAGTTGCAACGGGTTGATTATAGTGAC",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 57,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-6",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"349": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CAAACCATTATCCTCGATTGCAAGAACGAGCAGTTGGAACGGGTTGATTGTAGTGAGG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 58,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-21",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"350": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CATATTCATCATCCTCGACTGCAAGAAAGAACAGTTGGAACGGGTTGAATATAGTGAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 58,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-3",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"351": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CTCCTCATTATTCACGAATGATAGCACGAATAGTGTGAACGGGTTGATTATAGTGGCG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 58,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-5",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"352": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CTCCTCATTATTCTAGAATGATAGCACGAATAGTGTGAACGGGTTGATTATAGTGGCG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 58,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-17",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"353": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CAGCTCATTATTCACGAATGATGCACGAATAGTGTGAACGGGTTGATTATAGTGGG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 56,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-4",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"354": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "AACCCTCATTATCCACCAATGATAGCACGAATAGTGTGAGCGGGTTGATTATAGTGAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 58,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-12",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"355": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CTACCCATTATTCACGAATGATAGCACGAATAGTGTGAACGGGTTGATTATAGTGAC",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 57,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-20",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"356": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "AGGACTCATTAAGCTCGATTGCTCGAACGAACGGTTGGCACGGGTTGATTATAGTG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 56,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-14",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"357": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CGCAGCATTATGCTCGCATGCCCGAACGAACGGTTGGCACGGGTTGATTATAGTGGG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 57,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-8",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"358": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CGACTGGTTTTGCTCGTTTCTTCGTAGGAACAGATGTAATGGGTTGATATAGTGGCG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 57,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-2",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"359": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CGACTGGCTCTGCTCGTTTCTTCGAATGAACAGATGTAGTGGGTTGATATAGCGCG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 56,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-10",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"360": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CGACTAATCATGCTCGAATGTTCGTAAGAACAGTCTGTGCGGGTGGAATATAGTGAG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 57,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-16",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"361": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "ACTGACTCATACTGCACGCTTGTCCCTAAGGTAGTTGCGCAGGTGGAATATAGTGGG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 57,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-1",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"362": {
"buffer": "25 mM MgCl2, 25 mM EPPS pH 8.5",
"e": "CTACGGGTTATGGTTGATTATACGTAAAAACAGTTAGGATGAGTTGTTGGTCGTGG",
"fg1s": [
"2',3'-diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "d(GAACTGACGAACTGATGCTCAC)-r(UAUA)",
"length": 56,
"linkage": "2',5'",
"main_article_first_author": "N Paul",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "G Springsteen",
"main_article_pub_date": "2006",
"main_article_title": "Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-11",
"notes": "evolved from R3C ribozyme N51, binding arms anotated together with the catalytic core",
"r": "GAGACCGUAAUGAGUAG",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"363": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CCGGCCACGGCGTCAGTGAGGCAAGACTTCC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-adenylate"
],
"kinetics": "y",
"l": "TAATACGrACTCACTATA",
"length": 31,
"linkage": "A8",
"main_article_first_author": "T P Mui",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "Convergent and general one-step DNA-catalyzed synthesis of multiply branched DNA.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "15HA9",
"notes": "Pool N15-GTGAG-N7",
"r": "GGAAGAGATGGCGACGG",
"rate_constant": "kobs = 0.056 h-1 for branch-site nucleotide rU",
"reaction": "DNA ligation",
"reported_in": "m",
"rp": "branched DNA",
"s": "",
"structures": [],
"x": "",
"yield": ">90"
},
"364": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CCGTAGGTGAAGGGCGTGAGGGTTCCATTCC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAUAAUACGUCUCAC",
"length": 31,
"linkage": "A8",
"main_article_first_author": "E Zelin",
"main_article_last_autor": "Scott K Silverman",
"main_article_mid_authors": "Yangming Wang",
"main_article_pub_date": "2006",
"main_article_title": "Adenosine is inherently favored as the branch-site RNA nucleotide in a structural context that resembles natural RNA splicing.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10DM24",
"notes": "Pool N15-GTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.26 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": null,
"structures": [],
"x": null,
"yield": ">85"
},
"365": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CGGTAAGGCCAGGGCGTGAGGGTCCGCTTCC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAUAAUACGUCUCAC",
"length": 31,
"linkage": "A8",
"main_article_first_author": "E Zelin",
"main_article_last_autor": "Scott K Silverman",
"main_article_mid_authors": "Yangming Wang",
"main_article_pub_date": "2006",
"main_article_title": "Adenosine is inherently favored as the branch-site RNA nucleotide in a structural context that resembles natural RNA splicing.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10DM3",
"notes": "Pool N15-GTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.18 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ">80"
},
"366": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CATTATGCGAAGGGCGTGAGGGTTCCGTTCC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAUAAUACGUCUCAC",
"length": 31,
"linkage": "A8",
"main_article_first_author": "E Zelin",
"main_article_last_autor": "Scott K Silverman",
"main_article_mid_authors": "Yangming Wang",
"main_article_pub_date": "2006",
"main_article_title": "Adenosine is inherently favored as the branch-site RNA nucleotide in a structural context that resembles natural RNA splicing.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10DM5",
"notes": "Pool N15-GTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.32 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": "75"
},
"367": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CCTGTGGCAAAGGGCGTGAGGGTACTGTTCC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAUAAUACGUCUCAC",
"length": 31,
"linkage": "A8",
"main_article_first_author": "E Zelin",
"main_article_last_autor": "Scott K Silverman",
"main_article_mid_authors": "Yangming Wang",
"main_article_pub_date": "2006",
"main_article_title": "Adenosine is inherently favored as the branch-site RNA nucleotide in a structural context that resembles natural RNA splicing.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10DM10",
"notes": "Pool N15-GTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.31 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": "80"
},
"368": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CCTATGGCCCAGGGCGTGAGGGTGCGGTTCC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAUAAUACGUCUCAC",
"length": 31,
"linkage": "A8",
"main_article_first_author": "E Zelin",
"main_article_last_autor": "Scott K Silverman",
"main_article_mid_authors": "Yangming Wang",
"main_article_pub_date": "2006",
"main_article_title": "Adenosine is inherently favored as the branch-site RNA nucleotide in a structural context that resembles natural RNA splicing.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10DM19",
"notes": "Pool N15-GTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.27 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ">80"
},
"369": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "AGTGTGCTGCTAGGGCGTGAGGGTCCGCTTCC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAUAAUACGUCUCAC",
"length": 32,
"linkage": "A8",
"main_article_first_author": "E Zelin",
"main_article_last_autor": "Scott K Silverman",
"main_article_mid_authors": "Yangming Wang",
"main_article_pub_date": "2006",
"main_article_title": "Adenosine is inherently favored as the branch-site RNA nucleotide in a structural context that resembles natural RNA splicing.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10DM21",
"notes": "Pool N15-GTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.19 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": "90"
},
"370": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CCGGCAGGCAAGGGTGTGAGGGCTCGGTTCC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAUAAUACGUCUCAC",
"length": 31,
"linkage": "A8",
"main_article_first_author": "E Zelin",
"main_article_last_autor": "Scott K Silverman",
"main_article_mid_authors": "Yangming Wang",
"main_article_pub_date": "2006",
"main_article_title": "Adenosine is inherently favored as the branch-site RNA nucleotide in a structural context that resembles natural RNA splicing.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "7DM3",
"notes": "Pool N15-GTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.11 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": "90"
},
"371": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CCGTAGGCAAAGGGCGTGAGGGCTCGGTTCC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAUAAUACGUCUCAC",
"length": 31,
"linkage": "A8",
"main_article_first_author": "E Zelin",
"main_article_last_autor": "Scott K Silverman",
"main_article_mid_authors": "Yangming Wang",
"main_article_pub_date": "2006",
"main_article_title": "Adenosine is inherently favored as the branch-site RNA nucleotide in a structural context that resembles natural RNA splicing.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "7DM11",
"notes": "Pool N15-GTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.13 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": "90"
},
"372": {
"buffer": "50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CATTATGCCCAGGGCGTGAGGGTGCGGTTCC",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAUAAUACGUCUCAC",
"length": 31,
"linkage": "A8",
"main_article_first_author": "E Zelin",
"main_article_last_autor": "Scott K Silverman",
"main_article_mid_authors": "Yangming Wang",
"main_article_pub_date": "2006",
"main_article_title": "Adenosine is inherently favored as the branch-site RNA nucleotide in a structural context that resembles natural RNA splicing.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "7DM12",
"notes": "Pool N15-GTGAG-N7",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.15 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "",
"yield": ">80"
},
"373": {
"buffer": "50 mM CHES pH 9.0, 40 mM MgCl2",
"e": "CTACAGGACCCGCGCAAAAGTGATTTCAGAGGTATGGGTG",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "D R Semlow",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Parallel selections in vitro reveal a preference for 2'-5' RNA ligation upon deoxyribozyme-mediated opening of a 2',3'-cyclic phosphate.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "8BG11",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.2-0.3 h-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "25-35"
},
"374": {
"buffer": "50 mM CHES pH 9.0, 40 mM MgCl2",
"e": "CTAACTGTCAGATTCATCTAAAGATGGGGGGTTGTTTGAC",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 40,
"linkage": "2',5'",
"main_article_first_author": "D R Semlow",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Parallel selections in vitro reveal a preference for 2'-5' RNA ligation upon deoxyribozyme-mediated opening of a 2',3'-cyclic phosphate.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "8BG29",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.2-0.3 h-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "25-35"
},
"375": {
"buffer": "50 mM CHES pH 9.0, 40 mM MgCl2",
"e": "GGCGTTAAGGATTGGCGGAAACGGGTGGATCGCGGACC",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 38,
"linkage": "2',5'",
"main_article_first_author": "D R Semlow",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Parallel selections in vitro reveal a preference for 2'-5' RNA ligation upon deoxyribozyme-mediated opening of a 2',3'-cyclic phosphate.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "8BH6",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.2-0.3 h-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "25-35"
},
"376": {
"buffer": "50 mM CHES pH 9.0, 40 mM MgCl2",
"e": "AGGGACAAACCATAAGTCGCATCGGGTGGAACGTAGACC",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 39,
"linkage": "2',5'",
"main_article_first_author": "D R Semlow",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Parallel selections in vitro reveal a preference for 2'-5' RNA ligation upon deoxyribozyme-mediated opening of a 2',3'-cyclic phosphate.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "8BH41",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.2-0.3 h-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "25-35"
},
"377": {
"buffer": "50 mM CHES pH 9.0, 40 mM MgCl2",
"e": "GGCCGCTCACCCGTAGAACGGGTTGGATCCTAGGGGAC",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 38,
"linkage": "2',5'",
"main_article_first_author": "D R Semlow",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Parallel selections in vitro reveal a preference for 2'-5' RNA ligation upon deoxyribozyme-mediated opening of a 2',3'-cyclic phosphate.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "12BK15",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.2-0.3 h-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "25-35"
},
"378": {
"buffer": "50 mM CHES pH 9.0, 40 mM MgCl2",
"e": "GTCCAAGTGCAAAAGTCTTGAAGCCACTGCTAGGGCAC",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 38,
"linkage": "2',5'",
"main_article_first_author": "D R Semlow",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Parallel selections in vitro reveal a preference for 2'-5' RNA ligation upon deoxyribozyme-mediated opening of a 2',3'-cyclic phosphate.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "12BK21",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.2-0.3 h-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "25-35"
},
"379": {
"buffer": "50 mM CHES pH 9.0, 40 mM MgCl2",
"e": "GGACAATGGCACACAGTGTGGTCAGGAACTAGGTGATA",
"fg1s": [
"2',3'-cyclic phosphate"
],
"fg2s": [
"5'-OH"
],
"kinetics": "y",
"l": "UAAUACGACUCACUAUA",
"length": 38,
"linkage": "2',5'",
"main_article_first_author": "D R Semlow",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2005",
"main_article_title": "Parallel selections in vitro reveal a preference for 2'-5' RNA ligation upon deoxyribozyme-mediated opening of a 2',3'-cyclic phosphate.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "12BK29",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.2-0.3 h-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "non-native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "25-35"
},
"390": {
"buffer": "1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2",
"e": "TTCAGCGATGCACGCTTGTTTTAATGTTGCACCCATGTTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "R R Breaker",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1995",
"main_article_title": "A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "E0",
"notes": "MOST ACTIVE CLONE IN THE PRESENCE OF MG2+, RE-SELECTION PERFORMED FROM THIS SEQUENCE (SEQUENCES NAMES IE_#)",
"r": "",
"rate_constant": "kobs = 0.002 min-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "TCACTATrAGGAAGAGATG",
"structures": [],
"x": "",
"yield": ""
},
"391": {
"buffer": "1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2",
"e": "TACAGCGATTAACGCTTATTTTAGCGTTACACCCATGTTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "R R Breaker",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1995",
"main_article_title": "A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "E1",
"notes": "ie2",
"r": "",
"rate_constant": "kobs = 0.02 min-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "TCACTATrAGGAAGAGATG",
"structures": [],
"x": "",
"yield": ""
},
"392": {
"buffer": "1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2",
"e": "TTCAGCGATTAACGCTTATTTTAGCGTTACACCCATGTTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "R R Breaker",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1995",
"main_article_title": "A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "E2",
"notes": "ie4",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "TCACTATrAGGAAGAGATG",
"structures": [],
"x": "",
"yield": ""
},
"393": {
"buffer": "1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2",
"e": "TTCAGCGATTAACGGAACGTTACACCCATGTTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 33,
"linkage": "RNA phosphodiester",
"main_article_first_author": "R R Breaker",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1995",
"main_article_title": "A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "E5",
"notes": "truncated version of E2",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "TCACTATrAGGAAGAG",
"structures": [],
"x": "",
"yield": ""
},
"394": {
"buffer": "1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2",
"e": "TTCAGCGATCCGGAACGGCACCCATGTTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 29,
"linkage": "RNA phosphodiester",
"main_article_first_author": "R R Breaker",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1995",
"main_article_title": "A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "E6",
"notes": "truncated version of E2",
"r": "",
"rate_constant": "kcat = 0.039 min-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "TCACTATrAGGAAGAG",
"structures": [],
"x": "",
"yield": ""
},
"395": {
"buffer": "1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2",
"e": "ATCAGCGATTAACGCTTATTTTAGCATTACACCCATGTTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "R R Breaker",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1995",
"main_article_title": "A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "ie1",
"notes": "evolved from E0",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "TCACTATrAGGAAGAGATG",
"structures": [],
"x": "",
"yield": ""
},
"396": {
"buffer": "1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2",
"e": "ATCAGCGATTAACGCTTATTTTAGCGTTACACCCATGTTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "R R Breaker",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1995",
"main_article_title": "A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "ie3",
"notes": "evolved from E0",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "TCACTATrAGGAAGAGATG",
"structures": [],
"x": "",
"yield": ""
},
"397": {
"buffer": "1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2",
"e": "ATCAGCGATTAACGCTTGTTTCAATGTTACACCCATGTTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "R R Breaker",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1995",
"main_article_title": "A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "ie5",
"notes": "evolved from E0",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "TCACTATrAGGAAGAGATG",
"structures": [],
"x": "",
"yield": ""
},
"398": {
"buffer": "1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2",
"e": "ATCAGCGATTAACGCTTGTTTTAGTGTTGCACCCATGTTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "R R Breaker",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1995",
"main_article_title": "A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "ie6",
"notes": "evolved from E0",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "TCACTATrAGGAAGAGATG",
"structures": [],
"x": "",
"yield": ""
},
"399": {
"buffer": "1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2",
"e": "ATCAGCGATTCACCCTTGTTTAGGGTTGCACCCATGTTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 39,
"linkage": "RNA phosphodiester",
"main_article_first_author": "R R Breaker",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1995",
"main_article_title": "A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "ie7",
"notes": "evolved from E0",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "TCACTATrAGGAAGAGATG",
"structures": [],
"x": "",
"yield": ""
},
"400": {
"buffer": "1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2",
"e": "TACAGCGATTCACCCTTGTTTAAGGGTTACACCCATGTTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "R R Breaker",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1995",
"main_article_title": "A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "ie8",
"notes": "evolved from E0",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "TCACTATrAGGAAGAGATG",
"structures": [],
"x": "",
"yield": ""
},
"401": {
"buffer": "1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2",
"e": "ATCAGCGATTCACCCTTGTTTTAAGGTTGCACCCATGTTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "R R Breaker",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1995",
"main_article_title": "A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "ie9",
"notes": "evolved from E0",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "TCACTATrAGGAAGAGATG",
"structures": [],
"x": "",
"yield": ""
},
"402": {
"buffer": "1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2",
"e": "TTCAGCGATTCACCCTTGTTTTAAGGTTACACCCATGTTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "R R Breaker",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1995",
"main_article_title": "A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "ie10",
"notes": "evolved from E0",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "TCACTATrAGGAAGAGATG",
"structures": [],
"x": "",
"yield": ""
},
"403": {
"buffer": "1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2",
"e": "TACAGCGATTCACGATTGTTTTAACGTGACACCCATGTTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "R R Breaker",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1995",
"main_article_title": "A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "ie11",
"notes": "evolved from E0",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "TCACTATrAGGAAGAGATG",
"structures": [],
"x": "",
"yield": ""
},
"404": {
"buffer": "1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2",
"e": "TACAGCGATTCACGCCTGTTATATGCGTGCACCCATGTTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "R R Breaker",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1995",
"main_article_title": "A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "ie12",
"notes": "evolved from E0",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "TCACTATrAGGAAGAGATG",
"structures": [],
"x": "",
"yield": ""
},
"405": {
"buffer": "1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2",
"e": "TACAGCGATAACGCCTATTTTAGCGTTACACCCATGTTG",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 39,
"linkage": "RNA phosphodiester",
"main_article_first_author": "R R Breaker",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1995",
"main_article_title": "A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "ie13",
"notes": "evolved from E0",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "TCACTATrAGGAAGAGATG",
"structures": [],
"x": "",
"yield": ""
},
"406": {
"buffer": "1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2",
"e": "TACAGCGATCAACGCCTGTTATAATCGTGCACCCATGTTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "R R Breaker",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1995",
"main_article_title": "A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "ie14",
"notes": "evolved from E0",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "TCACTATrAGGAAGAGATG",
"structures": [],
"x": "",
"yield": ""
},
"407": {
"buffer": "1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2",
"e": "ATCAGCGATCAACGCTTCTCTTAACGTTGCACCCATGTTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "R R Breaker",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1995",
"main_article_title": "A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "ie15",
"notes": "evolved from E0",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "TCACTATrAGGAAGAGATG",
"structures": [],
"x": "",
"yield": ""
},
"408": {
"buffer": "1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2",
"e": "TACAGCGATCAACACTTGTTTCAATGTTGCACCCATGTTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "R R Breaker",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1995",
"main_article_title": "A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "ie16",
"notes": "evolved from E0",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "TCACTATrAGGAAGAGATG",
"structures": [],
"x": "",
"yield": ""
},
"409": {
"buffer": "1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2",
"e": "ATCAGCGATCCACGCTTATTTAAACGTGGCACCCATGTTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "R R Breaker",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1995",
"main_article_title": "A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "ie17",
"notes": "evolved from E0",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "TCACTATrAGGAAGAGATG",
"structures": [],
"x": "",
"yield": ""
},
"410": {
"buffer": "1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2",
"e": "TACAGCGATCCACGCTTGATTAAACGTGGCACCCATGTTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "R R Breaker",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1995",
"main_article_title": "A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "ie18",
"notes": "evolved from E0",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "TCACTATrAGGAAGAGATG",
"structures": [],
"x": "",
"yield": ""
},
"411": {
"buffer": "1 M NaCl, 50 mM HEPES pH 7.0, 1 mM MgCl2",
"e": "TATCAGCGATACACGTTTTTTTTAATGTGGCACCCATGTTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 41,
"linkage": "RNA phosphodiester",
"main_article_first_author": "R R Breaker",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1995",
"main_article_title": "A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "ie19",
"notes": "evolved from E0",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "TCACTATrAGGAAGAGATG",
"structures": [],
"x": "",
"yield": ""
},
"412": {
"buffer": "20 mM Histidine, 125 mM NaCl, 125 mM KCl, 50 mM Na2HPO4/NaH2PO4 pH 7.0, 0.5 mM MgCl2, 20 \u00b5M EDTA",
"e": "AAGCTCTCTCAGCGAGACGAAATAGGGAGTTAGCAGCACGAGGTTACACTTTTATCCTCTCCCAAAGTAGGGAC",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 74,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D Faulhammer",
"main_article_last_autor": "M Famulok",
"main_article_mid_authors": "",
"main_article_pub_date": "1996",
"main_article_title": "The Ca2+ Ion as a Cofactor for a Novel RNA\u2010Cleaving Deoxyribozyme",
"metal_ions": [
"Mg2+"
],
"n": "74",
"name": "class 1",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "GGGACGAATTCTAATACGACTCACTATrAGGAGCTCAGCCTTCACTGC",
"structures": [],
"x": "",
"yield": ""
},
"414": {
"buffer": "20 mM Histidine, 125 mM NaCl, 125 mM KCl, 50 mM Na2HPO4/NaH2PO4 pH 7.0, 0.5 mM MgCl2, 20 \u00b5M EDTA",
"e": "GGCATGTACCCAAGAAGGGGTGGAGCCGGCAGTGACCCCTGCGAGTAGGGAAGCCCAAGAACGAAGAGTTAAGC",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 74,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D Faulhammer",
"main_article_last_autor": "M Famulok",
"main_article_mid_authors": "",
"main_article_pub_date": "1996",
"main_article_title": "The Ca2+ Ion as a Cofactor for a Novel RNA\u2010Cleaving Deoxyribozyme",
"metal_ions": [
"Mg2+"
],
"n": "74",
"name": "class 3",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "GGGACGAATTCTAATACGACTCACTATrAGGAGCTCAGCCTTCACTGC",
"structures": [],
"x": "",
"yield": ""
},
"415": {
"buffer": "20 mM Histidine, 125 mM NaCl, 125 mM KCl, 50 mM Na2HPO4/NaH2PO4 pH 7.0, 0.5 mM MgCl2, 20 \u00b5M EDTA",
"e": "ATGCTGTTGCTCTGTCAGCGGACACGAAATAGTGGGTCGCGATGCTGAATAATCACGGCGAAAGTGGTTGCCTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 74,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D Faulhammer",
"main_article_last_autor": "M Famulok",
"main_article_mid_authors": "",
"main_article_pub_date": "1996",
"main_article_title": "The Ca2+ Ion as a Cofactor for a Novel RNA\u2010Cleaving Deoxyribozyme",
"metal_ions": [
"Mg2+"
],
"n": "74",
"name": "class 4",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "GGGACGAATTCTAATACGACTCACTATrAGGAGCTCAGCCTTCACTGC",
"structures": [],
"x": "",
"yield": ""
},
"416": {
"buffer": "20 mM Histidine, 125 mM NaCl, 125 mM KCl, 50 mM Na2HPO4/NaH2PO4 pH 7.0, 0.5 mM MgCl2, 20 \u00b5M EDTA",
"e": "CAGATGTGAAGTTAGAGCTTTGCCAGCnTCGTTAGTAGAGTCAGCGCACAGGGGAAGATTGTATGTCTATAG",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 72,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D Faulhammer",
"main_article_last_autor": "M Famulok",
"main_article_mid_authors": "",
"main_article_pub_date": "1996",
"main_article_title": "The Ca2+ Ion as a Cofactor for a Novel RNA\u2010Cleaving Deoxyribozyme",
"metal_ions": [
"Mg2+"
],
"n": "74",
"name": "class 5",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "GGGACGAATTCTAATACGACTCACTATrAGGAGCTCAGCCTTCACTGC",
"structures": [],
"x": "",
"yield": ""
},
"417": {
"buffer": "20 mM Histidine, 125 mM NaCl, 125 mM KCl, 50 mM Na2HPO4/NaH2PO4 pH 7.0, 0.5 mM MgCl2, 20 \u00b5M EDTA",
"e": "TAGGAAGTAGGGACCTACAAGTTGTCATTGTAACTGAGTTCTGCCAGCTGsACGAAATAGTCAGGAGTTAG",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 71,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D Faulhammer",
"main_article_last_autor": "M Famulok",
"main_article_mid_authors": "",
"main_article_pub_date": "1996",
"main_article_title": "The Ca2+ Ion as a Cofactor for a Novel RNA\u2010Cleaving Deoxyribozyme",
"metal_ions": [
"Mg2+"
],
"n": "74",
"name": "class 6",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "GGGACGAATTCTAATACGACTCACTATrAGGAGCTCAGCCTTCACTGC",
"structures": [],
"x": "",
"yield": ""
},
"418": {
"buffer": "20 mM Histidine, 125 mM NaCl, 125 mM KCl, 50 mM Na2HPO4/NaH2PO4 pH 7.0, 0.5 mM MgCl2, 20 \u00b5M EDTA",
"e": "CGTCATGCGAAAAGAATGGTGAGATTTGCCAGCsGTCGAGTAGTAGTCCAGGGAACATTGCCCGGGGGATT",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 71,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D Faulhammer",
"main_article_last_autor": "M Famulok",
"main_article_mid_authors": "",
"main_article_pub_date": "1996",
"main_article_title": "The Ca2+ Ion as a Cofactor for a Novel RNA\u2010Cleaving Deoxyribozyme",
"metal_ions": [
"Mg2+"
],
"n": "74",
"name": "class 7",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "GGGACGAATTCTAATACGACTCACTATrAGGAGCTCAGCCTTCACTGC",
"structures": [],
"x": "",
"yield": ""
},
"419": {
"buffer": "20 mM Histidine, 125 mM NaCl, 125 mM KCl, 50 mM Na2HPO4/NaH2PO4 pH 7.0, 0.5 mM MgCl2, 20 \u00b5M EDTA",
"e": "AGAACGGTAGAGTGCNGGGGGTGCAGTTGAGCTTTGTCAGCsACACGAATAAGAGTCTCGTAGGATTCACCAAG",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 74,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D Faulhammer",
"main_article_last_autor": "M Famulok",
"main_article_mid_authors": "",
"main_article_pub_date": "1996",
"main_article_title": "The Ca2+ Ion as a Cofactor for a Novel RNA\u2010Cleaving Deoxyribozyme",
"metal_ions": [
"Mg2+"
],
"n": "74",
"name": "class 8",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "GGGACGAATTCTAATACGACTCACTATrAGGAGCTCAGCCTTCACTGC",
"structures": [],
"x": "",
"yield": ""
},
"444": {
"buffer": "2 mM MgCl2, 150 mM NaCl, and 50 mM Tris\u22c5HCl pH 7.5",
"e": "TCCGAGCCGGACGA",
"fg1s": [
"2'-OH of A8"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": null,
"length": 14,
"linkage": "RNA phosphodiester",
"main_article_first_author": "S W Santoro",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1997",
"main_article_title": "A general purpose RNA-cleaving DNA enzyme.",
"metal_ions": [
"Mg2+",
"Zn2+",
"Pb2+",
"Ca2+"
],
"n": "50",
"name": "8-17",
"notes": "Obtained after re-selection",
"r": null,
"rate_constant": null,
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "NNNNNNNAGNNNNNN",
"structures": [
"5XMA",
"5XM9",
"5XM8"
],
"x": null,
"yield": null
},
"445": {
"buffer": "2 mM MgCl2, 150 mM NaCl, and 50 mM Tris\u22c5HCl pH 7.5",
"e": "RGGCTAGCTACAACGA",
"fg1s": [
"2'-OH of R8"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": null,
"length": 16,
"linkage": "RNA phosphodiester",
"main_article_first_author": "S W Santoro",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "1997",
"main_article_title": "A general purpose RNA-cleaving DNA enzyme.",
"metal_ions": [
"Mg2+"
],
"n": "50",
"name": "10-23",
"notes": "Obtained after re-selection",
"r": null,
"rate_constant": "kcat = 3.4 min-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "NNNNNNNRYNNNNNN",
"structures": [
"1BR3",
"1EGK"
],
"x": null,
"yield": null
},
"477": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GAACGTGGTGCGTGCTAACA",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": null,
"length": 20,
"linkage": "",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "20",
"name": "8VA2",
"notes": "consult reference to see deglycosylation site",
"r": null,
"rate_constant": "kobs = 0.12 h-1",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "deglycosylated DNA",
"s": "TAATACGACTCACTATCGAAGAGATGGCGACGGA",
"structures": [],
"x": null,
"yield": "35-45"
},
"478": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "AGATGTGGTGCGTGCCAAAA",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": null,
"length": 20,
"linkage": "",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "20",
"name": "8VA4",
"notes": "consult reference to see deglycosylation site",
"r": null,
"rate_constant": "kobs = 0.16 h-1",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "deglycosylated DNA",
"s": "TAATACGACTCACTATCGAAGAGATGGCGACGGA",
"structures": [],
"x": null,
"yield": "20-30"
},
"479": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "CACCAACCGCGCGATGGATC",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": null,
"length": 20,
"linkage": "DNA phosphodiester",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "20",
"name": "8VA5",
"notes": "hydrolysis site TAT^CGAA, phosphate after hydrolysis on 5'",
"r": null,
"rate_constant": "kobs = 0.011 h-1",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "hydrolyzed DNA",
"s": "TAATACGACTCACTATCGAAGAGATGGCGACGGA",
"structures": [],
"x": null,
"yield": "40-50"
},
"480": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "TAGACGTAAACTGGAGTTG",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": null,
"length": 19,
"linkage": "DNA phosphodiester",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "20",
"name": "8VA6",
"notes": "hydrolysis site TATC^GAA, phosphate after hydrolysis on 3'",
"r": null,
"rate_constant": "kobs = 0.19 h-1",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "hydrolyzed DNA",
"s": "TAATACGACTCACTATCGAAGAGATGGCGACGGA",
"structures": [],
"x": null,
"yield": "60-70"
},
"481": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "CGAATGTGGTGCGTGCTAAA",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": null,
"length": 20,
"linkage": "",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "20",
"name": "8VA10",
"notes": "consult reference to see deglycosylation site",
"r": null,
"rate_constant": "kobs = 0.22 h-1",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "deglycosylated DNA",
"s": "TAATACGACTCACTATCGAAGAGATGGCGACGGA",
"structures": [],
"x": null,
"yield": "60-70"
},
"482": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GAACTGTGGTGCGTGCCAAA",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": null,
"length": 20,
"linkage": "",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "20",
"name": "8VA11",
"notes": "consult reference to see deglycosylation site",
"r": null,
"rate_constant": "kobs = 0.19 h-1",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "deglycosylated DNA",
"s": "TAATACGACTCACTATCGAAGAGATGGCGACGGA",
"structures": [],
"x": null,
"yield": "55-65"
},
"483": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "AGGGGCGTGAGGGGTTCTTC",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": null,
"length": 20,
"linkage": "",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "20",
"name": "8VA23",
"notes": "consult reference to see deglycosylation site",
"r": null,
"rate_constant": "kobs = 0.051 h-1",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "deglycosylated DNA",
"s": "TAATACGACTCACTATCGAAGAGATGGCGACGGA",
"structures": [],
"x": null,
"yield": "50-60"
},
"484": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "TTAGGGAGGGCCACCAGCTT",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": null,
"length": 20,
"linkage": "",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "20",
"name": "8VA25",
"notes": "consult reference to see deglycosylation site",
"r": null,
"rate_constant": "kobs = 0.15 h-1",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "deglycosylated DNA",
"s": "TAATACGACTCACTATCGAAGAGATGGCGACGGA",
"structures": [],
"x": null,
"yield": "35-45"
},
"488": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "ATGGGGCACAGTTCTCTCATACCCCTGGAA",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": null,
"length": 30,
"linkage": "",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "30",
"name": "8VB1",
"notes": "consult reference to see deglycosylation site",
"r": null,
"rate_constant": "kobs = 0.052 h-1",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "deglycosylated DNA",
"s": "TAATACGACTCACTATCGAAGAGATGGCGACGGA",
"structures": [],
"x": null,
"yield": "40-50"
},
"489": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "TGGTTCGCACTTTCCAGGACAGGTAACCAC",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": null,
"length": 30,
"linkage": "",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "30",
"name": "8VB2",
"notes": "consult reference to see deglycosylation site",
"r": null,
"rate_constant": "kobs = 0.41 h-1",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "deglycosylated DNA",
"s": "TAATACGACTCACTATCGAAGAGATGGCGACGGA",
"structures": [],
"x": null,
"yield": "55-65"
},
"490": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "CGGACCCGGGCTCGACCTCGTGCTGAGCAT",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": null,
"length": 30,
"linkage": "DNA phosphodiester",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "30",
"name": "8VB4",
"notes": "hydrolysis site T^ATCGAA, phosphate after hydrolysis on 3'",
"r": null,
"rate_constant": "kobs = 0.18 h-1",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "hydrolyzed DNA",
"s": "TAATACGACTCACTATCGAAGAGATGGCGACGGA",
"structures": [],
"x": null,
"yield": "65-75"
},
"491": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "TACAGCACAGGAGTTACGTCCGGGTAAGTG",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": null,
"length": 30,
"linkage": "",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "30",
"name": "8VB5",
"notes": "consult reference to see deglycosylation site",
"r": null,
"rate_constant": "kobs = 0.52 h-1",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "deglycosylated DNA",
"s": "TAATACGACTCACTATCGAAGAGATGGCGACGGA",
"structures": [],
"x": null,
"yield": "55-65"
},
"492": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "CCTTGGTGAGAACGCACCTCACGGACGTGG",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": null,
"length": 30,
"linkage": "",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "30",
"name": "8VB7",
"notes": "consult reference to see deglycosylation site",
"r": null,
"rate_constant": "kobs = 0.14 h-1",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "deglycosylated DNA",
"s": "TAATACGACTCACTATCGAAGAGATGGCGACGGA",
"structures": [],
"x": null,
"yield": "25-35"
},
"493": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "CGGGGAATGGAGGCGTCCCAATGCAAATCG",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": null,
"length": 30,
"linkage": "",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "30",
"name": "8VB9",
"notes": "consult reference to see deglycosylation site",
"r": null,
"rate_constant": "kobs = 0.17 h-1",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "deglycosylated DNA",
"s": "TAATACGACTCACTATCGAAGAGATGGCGACGGA",
"structures": [],
"x": null,
"yield": "25-35"
},
"494": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "ACCGCGCGGAAGGCCTTTCTCGAAGGGCGA",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": null,
"length": 30,
"linkage": "",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "30",
"name": "8VB12",
"notes": "consult reference to see deglycosylation site",
"r": null,
"rate_constant": "kobs = 0.17 h-1",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "deglycosylated DNA",
"s": "TAATACGACTCACTATCGAAGAGATGGCGACGGA",
"structures": [],
"x": null,
"yield": "50-60"
},
"495": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "CCACTCCGTGCTCCTCTTGATGAGTAGGGC",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": null,
"length": 30,
"linkage": "",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "30",
"name": "8VB16",
"notes": "consult reference to see deglycosylation site",
"r": null,
"rate_constant": "kobs = 0.22 h-1",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "deglycosylated DNA",
"s": "TAATACGACTCACTATCGAAGAGATGGCGACGGA",
"structures": [],
"x": null,
"yield": "60-70"
},
"496": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "TACACTCATGGCGGTGTGATTCGATGCCGA",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": null,
"length": 30,
"linkage": "",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "30",
"name": "8VB18",
"notes": "consult reference to see deglycosylation site",
"r": null,
"rate_constant": "kobs = 0.23 h-1",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "deglycosylated DNA",
"s": "TAATACGACTCACTATCGAAGAGATGGCGACGGA",
"structures": [],
"x": null,
"yield": "35-45"
},
"497": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "TCGCGGCACATTAGTGTGAGTGGATCACGT",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": null,
"length": 30,
"linkage": "DNA phosphodiester",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "30",
"name": "8VB20",
"notes": "hydrolysis site TA^TCGAA, phosphate after hydrolysis on 5'",
"r": null,
"rate_constant": "kobs = 0.006 h-1",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "hydrolyzed DNA",
"s": "TAATACGACTCACTATCGAAGAGATGGCGACGGA",
"structures": [],
"x": null,
"yield": "35-45"
},
"498": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "ATCGGGTATTACGCGGACGGTTGCCCACCA",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": null,
"length": 30,
"linkage": "DNA phosphodiester",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "30",
"name": "8VB21",
"notes": "hydrolysis site TAT^CGAA, phosphate after hydrolysis on 3'",
"r": null,
"rate_constant": "kobs = 0.094 h-1",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "hydrolyzed DNA",
"s": "TAATACGACTCACTATCGAAGAGATGGCGACGGA",
"structures": [],
"x": null,
"yield": "60-70"
},
"499": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "CCGGCAGTGTGCTTGGGACAGCTTTGCTGG",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": null,
"length": 30,
"linkage": "",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "30",
"name": "8VB22",
"notes": "consult reference to see deglycosylation site",
"r": null,
"rate_constant": "kobs = 0.080 h-1",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "deglycosylated DNA",
"s": "TAATACGACTCACTATCGAAGAGATGGCGACGGA",
"structures": [],
"x": null,
"yield": "30-40"
},
"500": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "CAGGGGCGGTAGGCGTTACACTCAAATTGA",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": null,
"length": 30,
"linkage": "",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "30",
"name": "8VB25",
"notes": "consult reference to see deglycosylation site",
"r": null,
"rate_constant": "kobs = 0.086 h-1",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "deglycosylated DNA",
"s": "TAATACGACTCACTATCGAAGAGATGGCGACGGA",
"structures": [],
"x": null,
"yield": "40-50"
},
"501": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "CCAGGATCAATGATAAGCCGAGTCAAAGGG",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": null,
"length": 30,
"linkage": "",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "30",
"name": "8VB26",
"notes": "consult reference to see deglycosylation site",
"r": null,
"rate_constant": "kobs = 0.041 h-1",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "deglycosylated DNA",
"s": "TAATACGACTCACTATCGAAGAGATGGCGACGGA",
"structures": [],
"x": null,
"yield": "25-35"
},
"505": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl, 2 mM KCl",
"e": "GCGCTGGGAGGCACATGCTGGGTTGCACCG",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGATAATACGACTCACTATX",
"length": 30,
"linkage": "Tyr-RNA",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "30",
"name": "8TM3",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.15 h-1",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "HEG-Cys-Tyr-Ala",
"yield": "45-55"
},
"506": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl, 2 mM KCl",
"e": "GCGCTGGGAGGCATGAAAGGGTCTGCACCG",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGATAATACGACTCACTATX",
"length": 30,
"linkage": "Tyr-RNA ",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "30",
"name": "8TM8",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "HEG-Cys-Tyr-Ala",
"yield": ""
},
"507": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl, 2 mM KCl",
"e": "GCGCTGGGAGGCTAGTGCGGGGTTGCACCG",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGATAATACGACTCACTATX",
"length": 30,
"linkage": "Tyr-RNA ",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "30",
"name": "8TM12",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "HEG-Cys-Tyr-Ala",
"yield": ""
},
"508": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl, 2 mM KCl",
"e": "CAAGGAGAGCTGTACAAGCTCGGGTCGTGTTCAAAGGGATCATAGTGAGTACAAAACGG",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGATAATACGACTCACTATX",
"length": 59,
"linkage": "Tyr-RNA ",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "60",
"name": "7TQ20",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.073 h-1",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "HEG-Cys-Tyr-Ala",
"yield": "10-20"
},
"509": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl, 2 mM KCl",
"e": "CAAGGAGAGTTGTACAAGCTCGGGTCGTGTTCAAAGGGATCATAGTGAGTAGAAGGTCC",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGATAATACGACTCACTATX",
"length": 59,
"linkage": "Tyr-RNA ",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "60",
"name": "7TQ2",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "HEG-Cys-Tyr-Ala",
"yield": ""
},
"510": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl, 2 mM KCl",
"e": "CAAGGAGAGTTGTACAAGCTCGGGTCGTGTTCAAAGGGATCATAGTGAGTAGGGAGC",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGATAATACGACTCACTATX",
"length": 57,
"linkage": "Tyr-RNA ",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "60",
"name": "7TQ3",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "HEG-Cys-Tyr-Ala",
"yield": ""
},
"511": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl, 2 mM KCl",
"e": "CAAGGAGAGTTGTACAAGCTCGGGTCGTGTTCAAAGGTATCATAGTGAGGTAGTTAG",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGATAATACGACTCACTATX",
"length": 57,
"linkage": "Tyr-RNA ",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "60",
"name": "7TQ11",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "HEG-Cys-Tyr-Ala",
"yield": ""
},
"512": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl, 2 mM KCl",
"e": "CAAGGAGAGTTGTACAAGCTCGGGTCGTGTTCAAAGGGATCATAGTGAGTAGACGATTT",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGATAATACGACTCACTATX",
"length": 59,
"linkage": "Tyr-RNA ",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "60",
"name": "7TQ12",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "HEG-Cys-Tyr-Ala",
"yield": ""
},
"513": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl, 2 mM KCl",
"e": "CAAGGAGAGTTGTACAAGCTCGGGTCGTGTTCAAAGGGATCATAGTGAGTAGATAACCT",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGATAATACGACTCACTATX",
"length": 59,
"linkage": "Tyr-RNA ",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "60",
"name": "7TQ16",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "HEG-Cys-Tyr-Ala",
"yield": ""
},
"514": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl, 2 mM KCl",
"e": "CAAGGAGAGTTGTACAAGCTCGGGTCGTGTTCAAAGGTATCATAGTGAGTCGTGTCCAGT",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGATAATACGACTCACTATX",
"length": 60,
"linkage": "Tyr-RNA ",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "60",
"name": "7TQ53",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "HEG-Cys-Tyr-Ala",
"yield": ""
},
"515": {
"buffer": "50 mM HEPES pH 7.5, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl, 2 mM KCl",
"e": "CAAGGAGTGATCGTAGATCATGGGTCGTTCTGAAAGGCAGATAGTGAGTCATAAAACCACGG",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGATAATACGACTCACTATX",
"length": 62,
"linkage": "Tyr-RNA ",
"main_article_first_author": "T E Velez",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J Singh, Y Xiao, E C Allen, O Y Wong, M Chandra, S C Kwon",
"main_article_pub_date": "2012",
"main_article_title": "Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "60",
"name": "7TQ46",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "HEG-Cys-Tyr-Ala",
"yield": ""
},
"516": {
"buffer": "50 mM HEPES pH 7.5, 150 mM, NaCl, 2 mM KCl, 40 mM MgCl2, 20 mM MnCl2",
"e": "CAAGGAGCGTTGGACAAGCGCGGGTCGTTCCAAAAGTAGG",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA anchor-C3-CXA tripeptide",
"length": 40,
"linkage": "Tyr-RNA ",
"main_article_first_author": "O Y Wong",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "P I Pradeepkumar",
"main_article_pub_date": "2011",
"main_article_title": "DNA-catalyzed covalent modification of amino acid side chains in tethered and free peptide substrates.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "10KC3",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.28 h-1",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "Tyrosine or Serine",
"yield": "70"
},
"517": {
"buffer": "50 mM HEPES pH 7.5, 150 mM, NaCl, 2 mM KCl, 40 mM MgCl2, 20 mM MnCl2",
"e": "CAAGGAGTGCTGGAGAGGCACGGGTCGTGGCAAAAGTGTC",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-C3-CYA tripeptide",
"length": 40,
"linkage": "Tyr-RNA ",
"main_article_first_author": "O Y Wong",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "P I Pradeepkumar",
"main_article_pub_date": "2011",
"main_article_title": "DNA-catalyzed covalent modification of amino acid side chains in tethered and free peptide substrates.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "9NG14",
"notes": "Evolved from 10KC3",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 5.6 h-1",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": "77"
},
"518": {
"buffer": "50 mM HEPES pH 7.5, 150 mM, NaCl, 2 mM KCl, 40 mM MgCl2, 20 mM MnCl2",
"e": "CAAGGAGTGATCGTCGATCATGGGTCGTTCTGAAAGGCAG",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-C3-CYA tripeptide",
"length": 40,
"linkage": "Tyr-RNA ",
"main_article_first_author": "O Y Wong",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "P I Pradeepkumar",
"main_article_pub_date": "2011",
"main_article_title": "DNA-catalyzed covalent modification of amino acid side chains in tethered and free peptide substrates.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "9NG2",
"notes": "Evolved from 10KC3",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"519": {
"buffer": "50 mM HEPES pH 7.5, 150 mM, NaCl, 2 mM KCl, 40 mM MgCl2, 20 mM MnCl2",
"e": "CAAGGAGCGATGAACAAGCGCGGGTCGTTCCGAAAGCTGG",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-C3-CYA tripeptide",
"length": 40,
"linkage": "Tyr-RNA ",
"main_article_first_author": "O Y Wong",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "P I Pradeepkumar",
"main_article_pub_date": "2011",
"main_article_title": "DNA-catalyzed covalent modification of amino acid side chains in tethered and free peptide substrates.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "9NG3",
"notes": "Evolved from 10KC3",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"520": {
"buffer": "50 mM HEPES pH 7.5, 150 mM, NaCl, 2 mM KCl, 40 mM MgCl2, 20 mM MnCl2",
"e": "CAAGGAGAGTGGGAAAAGCTCGGGTCGTTCTCAAAGGGAG",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "DNA-C3-CYA tripeptide",
"length": 40,
"linkage": "Tyr-RNA ",
"main_article_first_author": "O Y Wong",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "P I Pradeepkumar",
"main_article_pub_date": "2011",
"main_article_title": "DNA-catalyzed covalent modification of amino acid side chains in tethered and free peptide substrates.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "9NG5",
"notes": "Evolved from 10KC3",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"521": {
"buffer": "50 mM HEPES pH 7.5, 150 mM, NaCl, 2 mM KCl, 40 mM MgCl2, 20 mM MnCl2",
"e": "CAAGGAACGTTGCACAAACGTGGGTCGTGGCCAAAAGGTC",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-C3-CYA tripeptide",
"length": 40,
"linkage": "Tyr-RNA ",
"main_article_first_author": "O Y Wong",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "P I Pradeepkumar",
"main_article_pub_date": "2011",
"main_article_title": "DNA-catalyzed covalent modification of amino acid side chains in tethered and free peptide substrates.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "9NG6",
"notes": "Evolved from 10KC3",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"522": {
"buffer": "50 mM HEPES pH 7.5, 150 mM, NaCl, 2 mM KCl, 40 mM MgCl2, 20 mM MnCl2",
"e": "CAAGGAGCGGTGGCCTACCGTGGGTCGTGTTCAAACGGATC",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "DNA-C3-CYA tripeptide",
"length": 41,
"linkage": "Tyr-RNA ",
"main_article_first_author": "O Y Wong",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "P I Pradeepkumar",
"main_article_pub_date": "2011",
"main_article_title": "DNA-catalyzed covalent modification of amino acid side chains in tethered and free peptide substrates.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "9NG15",
"notes": "Evolved from 10KC3",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"523": {
"buffer": "50 mM HEPES pH 7.5, 150 mM, NaCl, 2 mM KCl, 40 mM MgCl2, 20 mM MnCl2",
"e": "CAAGGAGGCACCTCGATAAGTGCCGGGTCGTTCCGAAAGCTGG",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-HEG-CYA tripeptide",
"length": 43,
"linkage": "Tyr-RNA ",
"main_article_first_author": "O Y Wong",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "P I Pradeepkumar",
"main_article_pub_date": "2011",
"main_article_title": "DNA-catalyzed covalent modification of amino acid side chains in tethered and free peptide substrates.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "11MN5",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"524": {
"buffer": "50 mM HEPES pH 7.5, 150 mM, NaCl, 2 mM KCl, 40 mM MgCl2, 20 mM MnCl2",
"e": "CAAGGAGCGAAGGTCAAGAGCGGGTCGTGGCAAAAGTGCA",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-HEG-CYA tripeptide",
"length": 40,
"linkage": "Tyr-RNA ",
"main_article_first_author": "O Y Wong",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "P I Pradeepkumar",
"main_article_pub_date": "2011",
"main_article_title": "DNA-catalyzed covalent modification of amino acid side chains in tethered and free peptide substrates.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "11MN10",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"525": {
"buffer": "50 mM HEPES pH 7.5, 150 mM, NaCl, 2 mM KCl, 40 mM MgCl2, 20 mM MnCl2",
"e": "CAAGGAGAGGTTGAGAATCTCGGGTCGTTTCCAAAGGGGA",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-HEG-CYA tripeptide",
"length": 40,
"linkage": "Tyr-RNA ",
"main_article_first_author": "O Y Wong",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "P I Pradeepkumar",
"main_article_pub_date": "2011",
"main_article_title": "DNA-catalyzed covalent modification of amino acid side chains in tethered and free peptide substrates.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "11MN19",
"notes": "",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"526": {
"buffer": "50 mM HEPES pH 7.5, 150 mM, NaCl, 2 mM KCl, 40 mM MgCl2, 20 mM MnCl2",
"e": "CAAGGAGAGTTGTACAAGCTCGGGTCGTGTTCAAAGGGATC",
"fg1s": [
"Ser"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-C3-CSA tripeptide",
"length": 41,
"linkage": "Ser-RNA",
"main_article_first_author": "O Y Wong",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "P I Pradeepkumar",
"main_article_pub_date": "2011",
"main_article_title": "DNA-catalyzed covalent modification of amino acid side chains in tethered and free peptide substrates.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "15MZ36",
"notes": "Strong activity with DNA-C3-CYA, DNA-HEG-CYA and free CYA substrates",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.50 h-1",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": null,
"structures": [],
"x": null,
"yield": "65"
},
"527": {
"buffer": "50 mM HEPES pH 7.5, 150 mM, NaCl, 2 mM KCl, 40 mM MgCl2, 20 mM MnCl2",
"e": "CAAGGAGCCCGGGACTAGGGCGGGTCGTGGCAAAAGTGTC",
"fg1s": [
"Ser"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-C3-CSA tripeptide",
"length": 40,
"linkage": "Ser-RNA",
"main_article_first_author": "O Y Wong",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "P I Pradeepkumar",
"main_article_pub_date": "2011",
"main_article_title": "DNA-catalyzed covalent modification of amino acid side chains in tethered and free peptide substrates.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "15MZ30",
"notes": "Strong activity with DNA-C3-CYA and DNA-HEG-CYA substrates",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"528": {
"buffer": "50 mM HEPES pH 7.5, 150 mM, NaCl, 2 mM KCl, 40 mM MgCl2, 20 mM MnCl2",
"e": "CAAGGAGTGTTGGATAAACGCGGGTCGTGTTCAAAGGGATC",
"fg1s": [
"Ser"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-C3-CSA tripeptide",
"length": 41,
"linkage": "Ser-RNA",
"main_article_first_author": "O Y Wong",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "P I Pradeepkumar",
"main_article_pub_date": "2011",
"main_article_title": "DNA-catalyzed covalent modification of amino acid side chains in tethered and free peptide substrates.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "15MZ49",
"notes": "Strong activity with DNA-C3-CYA and DNA-HEG-CYA substrates",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"529": {
"buffer": "50 mM HEPES pH 7.5, 150 mM, NaCl, 2 mM KCl, 40 mM MgCl2, 20 mM MnCl2",
"e": "CAAGGAGACTTGTATAAAGTCGGGTCGTCTTCAAAGGGATG",
"fg1s": [
"Ser"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-C3-CSA tripeptide",
"length": 41,
"linkage": "Ser-RNA",
"main_article_first_author": "O Y Wong",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "P I Pradeepkumar",
"main_article_pub_date": "2011",
"main_article_title": "DNA-catalyzed covalent modification of amino acid side chains in tethered and free peptide substrates.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "6QG6",
"notes": "Obtained after reselection starting with 15MZ36",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"530": {
"buffer": "50 mM HEPES pH 7.5, 150 mM, NaCl, 2 mM KCl, 40 mM MgCl2, 20 mM MnCl2",
"e": "CAAGGAGGGTTGTAGCAGCCCGGGTCGTGTTGAAAGGCATC",
"fg1s": [
"Ser"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-C3-CSA tripeptide",
"length": 41,
"linkage": "Ser-RNA",
"main_article_first_author": "O Y Wong",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "P I Pradeepkumar",
"main_article_pub_date": "2011",
"main_article_title": "DNA-catalyzed covalent modification of amino acid side chains in tethered and free peptide substrates.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "6QG18",
"notes": "Obtained after reselection starting with 15MZ36",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"531": {
"buffer": "50 mM HEPES pH 7.5, 150 mM, NaCl, 2 mM KCl, 40 mM MgCl2, 20 mM MnCl2",
"e": "CAAGGAGCGTGGGACAAGAGCGGGTCGTGTTCAAAGGGATC",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-C3-CYA tripeptide",
"length": 41,
"linkage": "Tyr-RNA",
"main_article_first_author": "O Y Wong",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "P I Pradeepkumar",
"main_article_pub_date": "2011",
"main_article_title": "DNA-catalyzed covalent modification of amino acid side chains in tethered and free peptide substrates.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "15NZ11",
"notes": "Obtained after reselection starting with 15MZ36",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"532": {
"buffer": "50 mM HEPES pH 7.5, 150 mM, NaCl, 2 mM KCl, 40 mM MgCl2, 20 mM MnCl2",
"e": "CAAGGAGCGATAGTCATACGCGGGTCGTGGCAAAAGTGTC",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-C3-CYA tripeptide",
"length": 40,
"linkage": "Tyr-RNA",
"main_article_first_author": "O Y Wong",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "P I Pradeepkumar",
"main_article_pub_date": "2011",
"main_article_title": "DNA-catalyzed covalent modification of amino acid side chains in tethered and free peptide substrates.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "15NZ16",
"notes": "Obtained after reselection starting with 15MZ36",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"533": {
"buffer": "50 mm CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CACGACAGCTAGAAAGAGGTCTAAAAAGTACTCCGCAGTGAGCGACGCG",
"fg1s": [
"Tyr"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGATAATACGXTTCACTGCG",
"length": 49,
"linkage": "Tyr-RNA",
"main_article_first_author": "P I Pradeepkumar",
"main_article_last_autor": "Scott K Silverman",
"main_article_mid_authors": "Claudia H\u00f6bartner, Dana A Baum",
"main_article_pub_date": "2008",
"main_article_title": "DNA-catalyzed formation of nucleopeptide linkages.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "*",
"name": "Tyr1",
"notes": "Pool N33-CGCAGTGAG-N7, the deoxyribozyme's sequence is anotated with the 9-nt linker between the two initially randomized regions",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.06 min-1",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "Tyr",
"yield": "72"
},
"534": {
"buffer": "50 mm CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "GGTCAACAGTTTGGTTGGTTAAGTAGGGGGCCCCGCAGTGAGCAAGTTG",
"fg1s": [
"3'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGATAATACGXTTCACTGCG",
"length": 49,
"linkage": "DNA-Tyr-DNA-RNA",
"main_article_first_author": "P I Pradeepkumar",
"main_article_last_autor": "Scott K Silverman",
"main_article_mid_authors": "Claudia H\u00f6bartner, Dana A Baum",
"main_article_pub_date": "2008",
"main_article_title": "DNA-catalyzed formation of nucleopeptide linkages.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "Tyr13",
"notes": "Pool N33-CGCAGTGAG-N7, the deoxyribozyme's sequence is anotated with the 9-nt linker between the two initially randomized regions",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": " Tyr, Ala, Ser, rA, dA",
"yield": ""
},
"535": {
"buffer": "50 mm CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "AAACGCAGGAAAAGCAACTCTTTTCTGGATGTGCGCAGTGAGCGACGCG",
"fg1s": [
"Ser"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGATAATACGXTTCACTGCG",
"length": 49,
"linkage": "Ser-RNA",
"main_article_first_author": "P I Pradeepkumar",
"main_article_last_autor": "Scott K Silverman",
"main_article_mid_authors": "Claudia H\u00f6bartner, Dana A Baum",
"main_article_pub_date": "2008",
"main_article_title": "DNA-catalyzed formation of nucleopeptide linkages.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "Ser7",
"notes": "Pool N33-CGCAGTGAG-N7, the deoxyribozyme's sequence is anotated with the 9-nt linker between the two initially randomized regions",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "Ser",
"yield": ""
},
"536": {
"buffer": "50 mm CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2",
"e": "CAGCTATATGTGCTGGACTGAGAGGGGTAGTTTCGCAGTGAGGTGTAGG",
"fg1s": [
"internal 2'-OH"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGATAATACGXTTCACTGCG",
"length": 49,
"linkage": "branch-site nucleotide X",
"main_article_first_author": "P I Pradeepkumar",
"main_article_last_autor": "Scott K Silverman",
"main_article_mid_authors": "Claudia H\u00f6bartner, Dana A Baum",
"main_article_pub_date": "2008",
"main_article_title": "DNA-catalyzed formation of nucleopeptide linkages.",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "9HR17",
"notes": "Pool N33-CGCAGTGAG-N7, the deoxyribozyme's sequence is anotated with the 9-nt linker between the two initially randomized regions",
"r": "GGAAGAGAUGGCGACGG",
"rate_constant": "kobs = 0.0094 min-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "branched RNA",
"s": "",
"structures": [],
"x": "rA, rC",
"yield": "61"
},
"538": {
"buffer": "50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2",
"e": "AGTCGGCCCCAGCTGGTTCGC",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 21,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M V Sednev",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "Volodymyr Mykhailiuk, Priyanka Choudhury, Julia Halang, Katherine E Sloan, Markus T Bohnsack",
"main_article_pub_date": "2018",
"main_article_title": "N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "VMA8",
"notes": "",
"r": "",
"rate_constant": "kobs = 0.27 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "cleavage after G15",
"s": "AUAGACUGAAUGAAGGXCUUCCGUAACU",
"structures": [],
"x": "m6A",
"yield": "65"
},
"539": {
"buffer": "50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2",
"e": "GAGGGTTTCTAGGGGACGTG",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 20,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M V Sednev",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "Volodymyr Mykhailiuk, Priyanka Choudhury, Julia Halang, Katherine E Sloan, Markus T Bohnsack",
"main_article_pub_date": "2018",
"main_article_title": "N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "VMA11",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "cleavage after G15",
"s": "AUAGACUGAAUGAAGGXCUUCCGUAACU",
"structures": [],
"x": "m6A",
"yield": ""
},
"540": {
"buffer": "50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2",
"e": "AAAGGGCGGGCAAACTCTGG",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 20,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M V Sednev",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "Volodymyr Mykhailiuk, Priyanka Choudhury, Julia Halang, Katherine E Sloan, Markus T Bohnsack",
"main_article_pub_date": "2018",
"main_article_title": "N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "VMA15",
"notes": "",
"r": "",
"rate_constant": "kobs = 0.60 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "cleavage after G16",
"s": "AUAGACUGAAUGAAGGXCUUCCGUAACU",
"structures": [],
"x": "m6A",
"yield": "80"
},
"541": {
"buffer": "50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2",
"e": "GGTCTAGTGGGTTCCTGGCTC",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 21,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M V Sednev",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "Volodymyr Mykhailiuk, Priyanka Choudhury, Julia Halang, Katherine E Sloan, Markus T Bohnsack",
"main_article_pub_date": "2018",
"main_article_title": "N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "VMA14",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "cleavage after G16",
"s": "AUAGACUGAAUGAAGGXCUUCCGUAACU",
"structures": [],
"x": "m6A",
"yield": ""
},
"542": {
"buffer": "50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2",
"e": "AAGGATTGCCGGAACTGGGG",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 20,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M V Sednev",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "Volodymyr Mykhailiuk, Priyanka Choudhury, Julia Halang, Katherine E Sloan, Markus T Bohnsack",
"main_article_pub_date": "2018",
"main_article_title": "N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "VMA1",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "cleavage after G16",
"s": "AUAGACUGAAUGAAGGXCUUCCGUAACU",
"structures": [],
"x": "m6A",
"yield": ""
},
"543": {
"buffer": "50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2",
"e": "TTGCGTAGCGCCTGGGCACC",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 20,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M V Sednev",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "Volodymyr Mykhailiuk, Priyanka Choudhury, Julia Halang, Katherine E Sloan, Markus T Bohnsack",
"main_article_pub_date": "2018",
"main_article_title": "N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "VMA2",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "cleavage after C18",
"s": "AUAGACUGAAUGAAGGXCUUCCGUAACU",
"structures": [],
"x": "m6A",
"yield": ""
},
"544": {
"buffer": "50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2",
"e": "GGGGTATCGGGGGGTGTAC",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 19,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M V Sednev",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "Volodymyr Mykhailiuk, Priyanka Choudhury, Julia Halang, Katherine E Sloan, Markus T Bohnsack",
"main_article_pub_date": "2018",
"main_article_title": "N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "VMA5",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "cleavage after A17",
"s": "AUAGACUGAAUGAAGGXCUUCCGUAACU",
"structures": [],
"x": "m6A",
"yield": ""
},
"545": {
"buffer": "50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2",
"e": "GGTCTCGCGGGGCCTGGCTC",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 20,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M V Sednev",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "Volodymyr Mykhailiuk, Priyanka Choudhury, Julia Halang, Katherine E Sloan, Markus T Bohnsack",
"main_article_pub_date": "2018",
"main_article_title": "N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "VMB1",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "cleavage after G16",
"s": "AUAGACUGAAUGAAGGXCUUCCGUAACU",
"structures": [],
"x": "m6A",
"yield": ""
},
"546": {
"buffer": "50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2",
"e": "GGTCTTGCGGGTCCTGGCTC",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 20,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M V Sednev",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "Volodymyr Mykhailiuk, Priyanka Choudhury, Julia Halang, Katherine E Sloan, Markus T Bohnsack",
"main_article_pub_date": "2018",
"main_article_title": "N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "VMB39",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "cleavage after G16",
"s": "AUAGACUGAAUGAAGGXCUUCCGUAACU",
"structures": [],
"x": "m6A",
"yield": ""
},
"547": {
"buffer": "50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2",
"e": "AAGGATCCGAGCAACTTCGGC",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 21,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M V Sednev",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "Volodymyr Mykhailiuk, Priyanka Choudhury, Julia Halang, Katherine E Sloan, Markus T Bohnsack",
"main_article_pub_date": "2018",
"main_article_title": "N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "VMB15",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "cleavage after G16",
"s": "AUAGACUGAAUGAAGGXCUUCCGUAACU",
"structures": [],
"x": "m6A",
"yield": ""
},
"548": {
"buffer": "50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2",
"e": "GATTCCAGGGCTTGAGGAGG",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 20,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M V Sednev",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "Volodymyr Mykhailiuk, Priyanka Choudhury, Julia Halang, Katherine E Sloan, Markus T Bohnsack",
"main_article_pub_date": "2018",
"main_article_title": "N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "VMB10",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "n.d.",
"s": "AUAGACUGAAUGAAGGXCUUCCGUAACU",
"structures": [],
"x": "m6A",
"yield": ""
},
"549": {
"buffer": "50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2",
"e": "GGAGCGCAGTCTGTTGGGGG",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 20,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M V Sednev",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "Volodymyr Mykhailiuk, Priyanka Choudhury, Julia Halang, Katherine E Sloan, Markus T Bohnsack",
"main_article_pub_date": "2018",
"main_article_title": "N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "VMB33",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "n.d.",
"s": "AUAGACUGAAUGAAGGXCUUCCGUAACU",
"structures": [],
"x": "m6A",
"yield": ""
},
"550": {
"buffer": "50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2",
"e": "GGGTCTCCAGCTGGACGTTA",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 20,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M V Sednev",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "Volodymyr Mykhailiuk, Priyanka Choudhury, Julia Halang, Katherine E Sloan, Markus T Bohnsack",
"main_article_pub_date": "2018",
"main_article_title": "N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "VMC10",
"notes": "",
"r": "",
"rate_constant": "kobs = 0.26 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "cleavage after G16",
"s": "AUAGACUGAAUGAAGGACUUCCGUAACU",
"structures": [],
"x": "",
"yield": "65"
},
"551": {
"buffer": "50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2",
"e": "GGTCTCGCGGGTCCTGGCTC",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 20,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M V Sednev",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "Volodymyr Mykhailiuk, Priyanka Choudhury, Julia Halang, Katherine E Sloan, Markus T Bohnsack",
"main_article_pub_date": "2018",
"main_article_title": "N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "VMC6",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "cleavage after G16",
"s": "AUAGACUGAAUGAAGGACUUCCGUAACU",
"structures": [],
"x": "",
"yield": ""
},
"552": {
"buffer": "50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2",
"e": "GGTTCGGTTGAGTGGGGCGA",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 20,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M V Sednev",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "Volodymyr Mykhailiuk, Priyanka Choudhury, Julia Halang, Katherine E Sloan, Markus T Bohnsack",
"main_article_pub_date": "2018",
"main_article_title": "N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "VMC17",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "cleavage after G15",
"s": "AUAGACUGAAUGAAGGACUUCCGUAACU",
"structures": [],
"x": "",
"yield": ""
},
"553": {
"buffer": "50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2",
"e": "GCGTGGCGTGGGACCGATGG",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 20,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M V Sednev",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "Volodymyr Mykhailiuk, Priyanka Choudhury, Julia Halang, Katherine E Sloan, Markus T Bohnsack",
"main_article_pub_date": "2018",
"main_article_title": "N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "VMC1",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "n.d.",
"s": "AUAGACUGAAUGAAGGACUUCCGUAACU",
"structures": [],
"x": "",
"yield": ""
},
"554": {
"buffer": "50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2",
"e": "AGATCGGTGACGTCGTTGTG",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 20,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M V Sednev",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "Volodymyr Mykhailiuk, Priyanka Choudhury, Julia Halang, Katherine E Sloan, Markus T Bohnsack",
"main_article_pub_date": "2018",
"main_article_title": "N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "VMC4",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "n.d.",
"s": "AUAGACUGAAUGAAGGACUUCCGUAACU",
"structures": [],
"x": "",
"yield": ""
},
"555": {
"buffer": "50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2",
"e": "CAGGACCCGAGCAACTTCGGC",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 21,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M V Sednev",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "Volodymyr Mykhailiuk, Priyanka Choudhury, Julia Halang, Katherine E Sloan, Markus T Bohnsack",
"main_article_pub_date": "2018",
"main_article_title": "N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "VMD1",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "cleavage at G16",
"s": "AUAGACUGAAUGAAGGACUUCCGUAACU",
"structures": [],
"x": "",
"yield": ""
},
"556": {
"buffer": "50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2",
"e": "GGGATTCCAGCTGGACGTTG",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 20,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M V Sednev",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "Volodymyr Mykhailiuk, Priyanka Choudhury, Julia Halang, Katherine E Sloan, Markus T Bohnsack",
"main_article_pub_date": "2018",
"main_article_title": "N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "VMD35",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "cleavage at G16",
"s": "AUAGACUGAAUGAAGGACUUCCGUAACU",
"structures": [],
"x": "",
"yield": ""
},
"557": {
"buffer": "50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2",
"e": "CGGCAGGGTCGGCACACGCG",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 20,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M V Sednev",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "Volodymyr Mykhailiuk, Priyanka Choudhury, Julia Halang, Katherine E Sloan, Markus T Bohnsack",
"main_article_pub_date": "2018",
"main_article_title": "N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "VMD3",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "n.d.",
"s": "AUAGACUGAAUGAAGGACUUCCGUAACU",
"structures": [],
"x": "",
"yield": ""
},
"558": {
"buffer": "50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2",
"e": "ACAGGAGCGGGTGGCCATGG",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 20,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M V Sednev",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "Volodymyr Mykhailiuk, Priyanka Choudhury, Julia Halang, Katherine E Sloan, Markus T Bohnsack",
"main_article_pub_date": "2018",
"main_article_title": "N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "VMD13",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "n.d.",
"s": "AUAGACUGAAUGAAGGACUUCCGUAACU",
"structures": [],
"x": "",
"yield": ""
},
"559": {
"buffer": "50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2",
"e": "GGCGGTGTGATCCAGGCAG",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 19,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M V Sednev",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "Volodymyr Mykhailiuk, Priyanka Choudhury, Julia Halang, Katherine E Sloan, Markus T Bohnsack",
"main_article_pub_date": "2018",
"main_article_title": "N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "VMD32",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "n.d.",
"s": "AUAGACUGAAUGAAGGACUUCCGUAACU",
"structures": [],
"x": "",
"yield": ""
},
"560": {
"buffer": "50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2",
"e": "GGAGCCAGTCTAGTGGGGGG",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 20,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M V Sednev",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "Volodymyr Mykhailiuk, Priyanka Choudhury, Julia Halang, Katherine E Sloan, Markus T Bohnsack",
"main_article_pub_date": "2018",
"main_article_title": "N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "VMD43",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "n.d.",
"s": "AUAGACUGAAUGAAGGACUUCCGUAACU",
"structures": [],
"x": "",
"yield": ""
},
"631": {
"buffer": "50 mM HEPES pH 7.0, 400 mM NaCl, 100 mM KCl, 15 mM MgCl2, 1 mM ATP, 1 mM GTP",
"e": "TAGCCAGGGATCGGGAAGAGGGCGGGGGTCAAGGAGGATCTATCTAGAGACTGGGTGGAGCAGGGGAAGG",
"fg1s": [
"GTP, ATP"
],
"fg2s": [
"5'-OH"
],
"kinetics": "n",
"l": "",
"length": 70,
"linkage": "",
"main_article_first_author": "W Wang",
"main_article_last_autor": "Y Li",
"main_article_mid_authors": "L P Billen",
"main_article_pub_date": "2002",
"main_article_title": "Sequence diversity, metal specificity, and catalytic proficiency of metal-dependent phosphorylating DNA enzymes.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "70",
"name": "Mg1",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "DNA phosphorylation",
"reported_in": "m",
"rp": "5'-self phosphorylated DNA",
"s": "GGAAGAGATGGCGAC-N70-AGCTGATCCTGATGG",
"structures": [],
"x": "",
"yield": ""
},
"632": {
"buffer": "50 mM HEPES pH 7.0, 400 mM NaCl, 100 mM KCl, 15 mM MgCl2, 1 mM ATP, 1 mM GTP",
"e": "GGAGCCTCCGTCGGACAGTGAAGGGTTAGTATGGCGTGACGGGGATGGTCGGGTTGAGCGGGAACAGTTG",
"fg1s": [
"GTP"
],
"fg2s": [
"5'-OH"
],
"kinetics": "n",
"l": "",
"length": 70,
"linkage": "",
"main_article_first_author": "W Wang",
"main_article_last_autor": "Y Li",
"main_article_mid_authors": "L P Billen",
"main_article_pub_date": "2002",
"main_article_title": "Sequence diversity, metal specificity, and catalytic proficiency of metal-dependent phosphorylating DNA enzymes.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Ca2+"
],
"n": "70",
"name": "Mg2",
"notes": "Identical to Cu10",
"r": "",
"rate_constant": "",
"reaction": "DNA phosphorylation",
"reported_in": "m",
"rp": "5'-self phosphorylated DNA",
"s": "GGAGAGATGGCGAC-N70-AGCTGATCCTGATGG",
"structures": [],
"x": "",
"yield": ""
},
"633": {
"buffer": "50 mM HEPES pH 7.0, 400 mM NaCl, 100 mM KCl, 15 mM MgCl2, 1 mM ATP, 1 mM GTP",
"e": "TTAGTAAGCCTATAGCCATCGCTGGGGCTTAAGAGCAGGGGGGCGGATGGGACCGAAGGTTGGCGTTGTA",
"fg1s": [
"GTP"
],
"fg2s": [
"5'-OH"
],
"kinetics": "n",
"l": "",
"length": 70,
"linkage": "",
"main_article_first_author": "W Wang",
"main_article_last_autor": "Y Li",
"main_article_mid_authors": "L P Billen",
"main_article_pub_date": "2002",
"main_article_title": "Sequence diversity, metal specificity, and catalytic proficiency of metal-dependent phosphorylating DNA enzymes.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Ca2+"
],
"n": "70",
"name": "Mg3",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "DNA phosphorylation",
"reported_in": "m",
"rp": "5'-self phosphorylated DNA",
"s": "GGAGAGATGGCGAT-N70-AGCTGATCCTGATGG",
"structures": [],
"x": "",
"yield": ""
},
"720": {
"buffer": "500 mM Tris-HCl, 1.5 M NaCl, 5mM MgCl2",
"e": "GGGTTCGGTGGAGCGGCGCGA",
"fg1s": [
"2'-OH of G15"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 21,
"linkage": "RNA phosphodiester",
"main_article_first_author": "A Liaqat",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "C Stiller, M Michel, M V Sednev",
"main_article_pub_date": "2020",
"main_article_title": "N 6-isopentenyladenosine in RNA determines the cleavage site of endonuclease deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "AA07",
"notes": "",
"r": "",
"rate_constant": "kobs = 0.0011 min-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "cleavage at G15",
"s": "AUAGACUGAAUGAAGGACUUCCGUAACU",
"structures": [],
"x": "",
"yield": "42"
},
"721": {
"buffer": "500 mM Tris-HCl, 1.5 M NaCl, 5mM MgCl2",
"e": "TGGTCTCGCGGTTCCTGGTTA",
"fg1s": [
"2'-OH of G15"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 21,
"linkage": "RNA phosphodiester",
"main_article_first_author": "A Liaqat",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "C Stiller, M Michel, M V Sednev",
"main_article_pub_date": "2020",
"main_article_title": "N 6-isopentenyladenosine in RNA determines the cleavage site of endonuclease deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "AA14",
"notes": "",
"r": "",
"rate_constant": "kobs = 0.0066 min-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "cleavage at G15",
"s": "AUAGACUGAAUGAAGGACUUCCGUAACU",
"structures": [],
"x": "",
"yield": "74"
},
"722": {
"buffer": "500 mM Tris-HCl, 1.5 M NaCl, 5mM MgCl2",
"e": "CCTGCAAGGAGGTTTACCGGG",
"fg1s": [
"2'-OH of G16"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 21,
"linkage": "RNA phosphodiester",
"main_article_first_author": "A Liaqat",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "C Stiller, M Michel, M V Sednev",
"main_article_pub_date": "2020",
"main_article_title": "N 6-isopentenyladenosine in RNA determines the cleavage site of endonuclease deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "AA17",
"notes": "",
"r": "",
"rate_constant": "kobs = 0.0065 min-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "cleavage at G16",
"s": "AUAGACUGAAUGAAGGACUUCCGUAACU",
"structures": [],
"x": "",
"yield": "77"
},
"723": {
"buffer": "500 mM Tris-HCl, 1.5 M NaCl, 5mM MgCl2",
"e": "GGGAAGCCAGTGGTACGTT",
"fg1s": [
"2'-OH of G16"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 19,
"linkage": "RNA phosphodiester",
"main_article_first_author": "A Liaqat",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "C Stiller, M Michel, M V Sednev",
"main_article_pub_date": "2020",
"main_article_title": "N 6-isopentenyladenosine in RNA determines the cleavage site of endonuclease deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "AB08",
"notes": "",
"r": "",
"rate_constant": "kobs = 0.0086 min-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "cleavage at G16",
"s": "AUAGACUGAAUGAAGGXCUUCCGUAACU",
"structures": [],
"x": "i6A",
"yield": "75"
},
"724": {
"buffer": "500 mM Tris-HCl, 1.5 M NaCl, 5mM MgCl2",
"e": "GGGTCTCCAGCCGGACGTTA",
"fg1s": [
"2'-OH of G16 / G15"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 20,
"linkage": "RNA phosphodiester",
"main_article_first_author": "A Liaqat",
"main_article_last_autor": "C H\u00f6bartner",
"main_article_mid_authors": "C Stiller, M Michel, M V Sednev",
"main_article_pub_date": "2020",
"main_article_title": "N 6-isopentenyladenosine in RNA determines the cleavage site of endonuclease deoxyribozymes.",
"metal_ions": [
"Mg2+"
],
"n": "20",
"name": "AC17",
"notes": "AC17 yields cleavage products with both unmodified and i6A-modified RNA substrates. For this reason, two substrates, as well as two different reaction products are indicated (for unmodified and modified substrates, respectively).",
"r": "",
"rate_constant": "kobs = 0.018 min-1 and kobs = 0.0016 min-1 for unmodified and i6A-modified RNA, respectively.",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "cleavage at G16 / G15",
"s": "AUAGACUGAAUGAAGGACUUCCGUAACU/ AUAGACUGAAUGAAGGXCUUCCGUAACU",
"structures": [],
"x": "i6A",
"yield": "82 and 51 for unmodified and i6A-modified RNA, respectively."
},
"758": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GCCGATAAGCAAAGCATCAGGAGTACGAACAGGTCCAAAT",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "ester",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A R Hesser, M A Castner, M Chandra",
"main_article_pub_date": "2013",
"main_article_title": "DNA-catalyzed hydrolysis of esters and aromatic amides.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "10ZA5",
"notes": "The ester substrate is covalently attached to a DNA anchor oligonucleotide.",
"r": "",
"rate_constant": "kobs = 0.51 h-1",
"reaction": "Ester hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "Ester",
"structures": [],
"x": "",
"yield": ">80"
},
"762": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "CCCCACGCGTAATGGGCACAATTCTTTGAGCTGTAATGCT",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "ester",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A R Hesser, M A Castner, M Chandra",
"main_article_pub_date": "2013",
"main_article_title": "DNA-catalyzed hydrolysis of esters and aromatic amides.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "10ZA18",
"notes": "The ester substrate is covalently attached to a DNA anchor oligonucleotide.",
"r": "",
"rate_constant": "kobs = 0.34 h-1",
"reaction": "Ester hydrolysis",
"reported_in": "m",
"rp": "Carboxylic acid",
"s": "Ester",
"structures": [],
"x": "",
"yield": "80"
},
"767": {
"buffer": "50 mM CHES pH 9.0, 40 mM MgCl2,150 mM NaCl",
"e": "GGGCGGCGAACAGGATGGGAGGAGGGACCTGGCAATACCG",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "ester",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A R Hesser, M A Castner, M Chandra",
"main_article_pub_date": "2013",
"main_article_title": "DNA-catalyzed hydrolysis of esters and aromatic amides.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "13ZB38",
"notes": "The ester substrate is covalently attached to a DNA anchor oligonucleotide.",
"r": "",
"rate_constant": "kobs = 3.1 h-1",
"reaction": "Ester hydrolysis",
"reported_in": "m",
"rp": "Carboxylic acid",
"s": "Ester",
"structures": [],
"x": "",
"yield": "80"
},
"768": {
"buffer": "50 mM CHES pH 9.0, 40 mM MgCl2,150 mM NaCl",
"e": "GGGGCAGCGAGCGTAAGCTGGGGGACCTGCTATTAGCTGC",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "ester",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A R Hesser, M A Castner, M Chandra",
"main_article_pub_date": "2013",
"main_article_title": "DNA-catalyzed hydrolysis of esters and aromatic amides.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "13ZB37",
"notes": "The ester substrate is covalently attached to a DNA anchor oligonucleotide.",
"r": "",
"rate_constant": "kobs = 0.56 h-1",
"reaction": "Ester hydrolysis",
"reported_in": "m",
"rp": "Carboxylic acid",
"s": "Ester",
"structures": [],
"x": "",
"yield": "80"
},
"769": {
"buffer": "50 mM CHES pH 9.0, 40 mM MgCl2,150 mM NaCl",
"e": "GGGGGCGCGTCATCATCGAAAGGGGGTCCTGCATTACGCC",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "ester",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A R Hesser, M A Castner, M Chandra",
"main_article_pub_date": "2013",
"main_article_title": "DNA-catalyzed hydrolysis of esters and aromatic amides.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "13ZB44",
"notes": "The ester substrate is covalently attached to a DNA anchor oligonucleotide.",
"r": "",
"rate_constant": "kobs = 1.7 h-1",
"reaction": "Ester hydrolysis",
"reported_in": "m",
"rp": "Carboxylic acid",
"s": "Ester",
"structures": [],
"x": "",
"yield": "70-80"
},
"770": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "ACAGGTCGGGAAGTTACATGCATGTCAATGTAACGGGTAC",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A R Hesser, M A Castner, M Chandra",
"main_article_pub_date": "2013",
"main_article_title": "DNA-catalyzed hydrolysis of esters and aromatic amides.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "8ZC9",
"notes": "The amide substrate is covalently attached to a DNA anchor oligonucleotide.",
"r": "",
"rate_constant": "kobs = 0.13 h-1",
"reaction": "Amide hydrolysis",
"reported_in": "m",
"rp": "Carboxylic acid",
"s": "Anilide (aromatic amide)",
"structures": [],
"x": "",
"yield": "70-80"
},
"772": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "ACGGGACGGGAAGCGTCACGAAAAGTCTAGACGCGGGTAA",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A R Hesser, M A Castner, M Chandra",
"main_article_pub_date": "2013",
"main_article_title": "DNA-catalyzed hydrolysis of esters and aromatic amides.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "8ZC8",
"notes": "The amide substrate is covalently attached to a DNA anchor oligonucleotide.",
"r": "",
"rate_constant": "kobs = 0.028 h-1",
"reaction": "Amide hydrolysis",
"reported_in": "m",
"rp": "Carboxylic acid",
"s": "Anilide (aromatic amide)",
"structures": [],
"x": "",
"yield": "30-40"
},
"775": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "ACGGGCCGGGAAGAAACAAGCTATACGAAGTTTCGGGTCA",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A R Hesser, M A Castner, M Chandra",
"main_article_pub_date": "2013",
"main_article_title": "DNA-catalyzed hydrolysis of esters and aromatic amides.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6AP102",
"notes": "The AP1 selection is the a reselection of the 8ZC9 deoxyribozyme. ",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "Anilide (aromatic amide)",
"structures": [],
"x": "",
"yield": ""
},
"776": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "ACAGGCCGGGAAGTGACGAGCAAGACGAGGAAACGGGTTC",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A R Hesser, M A Castner, M Chandra",
"main_article_pub_date": "2013",
"main_article_title": "DNA-catalyzed hydrolysis of esters and aromatic amides.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6AP103",
"notes": "The AP1 selection is the a reselection of the 8ZC9 deoxyribozyme",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "Anilide (aromatic amide)",
"structures": [],
"x": "",
"yield": ""
},
"777": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "ACAGGCCGGGAAGTGAGGAGCAAGACAACGAAACGGGTCC",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A R Hesser, M A Castner, M Chandra",
"main_article_pub_date": "2013",
"main_article_title": "DNA-catalyzed hydrolysis of esters and aromatic amides.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6AP108",
"notes": "The AP1 selection is the a reselection of the 8ZC9 deoxyribozyme",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "Anilide (aromatic amide)",
"structures": [],
"x": "",
"yield": ""
},
"778": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "ACGGGCCGGGAAGCAGTCAAAAGCGTTTGAATGCGGGTAT",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A R Hesser, M A Castner, M Chandra",
"main_article_pub_date": "2013",
"main_article_title": "DNA-catalyzed hydrolysis of esters and aromatic amides.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6AP112",
"notes": "The AP1 selection is the a reselection of the 8ZC9 deoxyribozyme",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "Anilide (aromatic amide)",
"structures": [],
"x": "",
"yield": ""
},
"779": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "ACAGGCCGGGAAGGAACAAGCAAGACTTAGTTCCGGGTGC",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A R Hesser, M A Castner, M Chandra",
"main_article_pub_date": "2013",
"main_article_title": "DNA-catalyzed hydrolysis of esters and aromatic amides.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6AP122",
"notes": "The AP1 selection is the a reselection of the 8ZC9 deoxyribozyme",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "Anilide (aromatic amide)",
"structures": [],
"x": "",
"yield": ""
},
"780": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "ACGGGCCGGGAAGGAACAAGTCACAACGAGAGACGGGTAA",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A R Hesser, M A Castner, M Chandra",
"main_article_pub_date": "2013",
"main_article_title": "DNA-catalyzed hydrolysis of esters and aromatic amides.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6AP134",
"notes": "The AP1 selection is the a reselection of the 8ZC9 deoxyribozyme",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "Anilide (aromatic amide)",
"structures": [],
"x": "",
"yield": ""
},
"781": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "ACAGGACGGGAAGGAGCAAGTAACACAACGCGACGGGTAC",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A R Hesser, M A Castner, M Chandra",
"main_article_pub_date": "2013",
"main_article_title": "DNA-catalyzed hydrolysis of esters and aromatic amides.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6AP136",
"notes": "The AP1 selection is the a reselection of the 8ZC9 deoxyribozyme",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "Anilide (aromatic amide)",
"structures": [],
"x": "",
"yield": ""
},
"782": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "ACAGGTCGGGAAGAGACAAGCAAAGCACAAACTCGGGTCC",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A R Hesser, M A Castner, M Chandra",
"main_article_pub_date": "2013",
"main_article_title": "DNA-catalyzed hydrolysis of esters and aromatic amides.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6AP138",
"notes": "The AP1 selection is the a reselection of the 8ZC9 deoxyribozyme",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "Anilide (aromatic amide)",
"structures": [],
"x": "",
"yield": ""
},
"783": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "ACAGGACGGGAAGCAACGAGCAAGACGAGGAAGCGGGTGC",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A R Hesser, M A Castner, M Chandra",
"main_article_pub_date": "2013",
"main_article_title": "DNA-catalyzed hydrolysis of esters and aromatic amides.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6AP139",
"notes": "The AP1 selection is the a reselection of the 8ZC9 deoxyribozyme",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "Anilide (aromatic amide)",
"structures": [],
"x": "",
"yield": ""
},
"784": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "ACAGGTCGGGAAGATTCATGCTAGACATAGAATCGGGTCG",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A R Hesser, M A Castner, M Chandra",
"main_article_pub_date": "2013",
"main_article_title": "DNA-catalyzed hydrolysis of esters and aromatic amides.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6AP143",
"notes": "The AP1 selection is the a reselection of the 8ZC9 deoxyribozyme",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "Anilide (aromatic amide)",
"structures": [],
"x": "",
"yield": ""
},
"785": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "ACAGGACGGGAAGATTCTAGCTTGCCAAAGAATCGGGTAC",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A R Hesser, M A Castner, M Chandra",
"main_article_pub_date": "2013",
"main_article_title": "DNA-catalyzed hydrolysis of esters and aromatic amides.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6AP144",
"notes": "The AP1 selection is the a reselection of the 8ZC9 deoxyribozyme",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "Anilide (aromatic amide)",
"structures": [],
"x": "",
"yield": ""
},
"786": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "ACGGGCCGGGAAGATACAAGCAAGACATTGTATCGGGTAC",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A R Hesser, M A Castner, M Chandra",
"main_article_pub_date": "2013",
"main_article_title": "DNA-catalyzed hydrolysis of esters and aromatic amides.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6AP145",
"notes": "The AP1 selection is the a reselection of the 8ZC9 deoxyribozyme",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "Anilide (aromatic amide)",
"structures": [],
"x": "",
"yield": ""
},
"787": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "ACAGGTCGGGAAGAAACTAGCTAGACACAGTTTCGGGTAC",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A R Hesser, M A Castner, M Chandra",
"main_article_pub_date": "2013",
"main_article_title": "DNA-catalyzed hydrolysis of esters and aromatic amides.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6AP146",
"notes": "The AP1 selection is the a reselection of the 8ZC9 deoxyribozyme",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "Anilide (aromatic amide)",
"structures": [],
"x": "",
"yield": ""
},
"944": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl ",
"e": "AGAGCGGGACTACGCAGTCACGCGAATCGCTAGTACGTGG",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "C Zhou",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J L Avins, P C Klauser, B M Brandsen, Y Lee",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Amide Hydrolysis.",
"metal_ions": [
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "8JV105 (AmideAm1)",
"notes": "* The amide substrate was prepared by solution-phase coupling of a 3'-CO2H oligonucleotide and a 5'-amino-5'-deoxythymidine oligonucleotide. For further details, please see the supplementary material of the publication. All dT nucleotides in the catalytic region of the DNAzyme are 5'-substituted 2'-deoxyuridine derivatives (AmdU).",
"r": "",
"rate_constant": "kobs = 0.11 h-1",
"reaction": "Amide hydrolysis",
"reported_in": "m",
"rp": "Carboxylic acid",
"s": "*Amide substrate embedded within DNA oligonucleotide complementary to the DNAzyme's binding arms.",
"structures": [],
"x": "",
"yield": "64"
},
"945": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl ",
"e": "AGAGCGAGACTACGCAGTCACGCGAATCGCTAGTACGTGG",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "C Zhou",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J L Avins, P C Klauser, B M Brandsen, Y Lee",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Amide Hydrolysis.",
"metal_ions": [
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "8JV113",
"notes": "* The amide substrate was prepared by solution-phase coupling of a 3'-CO2H oligonucleotide and a 5'-amino-5'-deoxythymidine oligonucleotide. For further details, please see the supplementary material of the publication. All dT nucleotides in the catalytic region of the DNAzyme are 5'-substituted 2'-deoxyuridine derivatives (AmdU).",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "*Amide substrate embedded within DNA oligonucleotide complementary to the DNAzyme's binding arms.",
"structures": [],
"x": "",
"yield": ""
},
"946": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl ",
"e": "AGAGCGGGACTACGCAGCCACGCGAATCGCTAGTACGTGG",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "C Zhou",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J L Avins, P C Klauser, B M Brandsen, Y Lee",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Amide Hydrolysis.",
"metal_ions": [
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "8JV108",
"notes": "* The amide substrate was prepared by solution-phase coupling of a 3'-CO2H oligonucleotide and a 5'-amino-5'-deoxythymidine oligonucleotide. For further details, please see the supplementary material of the publication. All dT nucleotides in the catalytic region of the DNAzyme are 5'-substituted 2'-deoxyuridine derivatives (AmdU).",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "*Amide substrate embedded within DNA oligonucleotide complementary to the DNAzyme's binding arms.",
"structures": [],
"x": "",
"yield": ""
},
"947": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl ",
"e": "AGAGCGGGACCACGCAGTCACGCGAATCGCTAGTACGTGG",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "C Zhou",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J L Avins, P C Klauser, B M Brandsen, Y Lee",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Amide Hydrolysis.",
"metal_ions": [
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "8JV111",
"notes": "* The amide substrate was prepared by solution-phase coupling of a 3'-CO2H oligonucleotide and a 5'-amino-5'-deoxythymidine oligonucleotide. For further details, please see the supplementary material of the publication. All dT nucleotides in the catalytic region of the DNAzyme are 5'-substituted 2'-deoxyuridine derivatives (AmdU).",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "*Amide substrate embedded within DNA oligonucleotide complementary to the DNAzyme's binding arms.",
"structures": [],
"x": "",
"yield": ""
},
"948": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl ",
"e": "AGAGCGGGGCTACGCAGTCACGCGAATCGCTAGTACGTGG",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "C Zhou",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J L Avins, P C Klauser, B M Brandsen, Y Lee",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Amide Hydrolysis.",
"metal_ions": [
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "8JV103",
"notes": "* The amide substrate was prepared by solution-phase coupling of a 3'-CO2H oligonucleotide and a 5'-amino-5'-deoxythymidine oligonucleotide. For further details, please see the supplementary material of the publication. All dT nucleotides in the catalytic region of the DNAzyme are 5'-substituted 2'-deoxyuridine derivatives (AmdU).",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "*Amide substrate embedded within DNA oligonucleotide complementary to the DNAzyme's binding arms.",
"structures": [],
"x": "",
"yield": ""
},
"949": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl ",
"e": "AGAGCGGGACTACGCAGTCACGCGAACCGCTAGTACGTGG",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "C Zhou",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J L Avins, P C Klauser, B M Brandsen, Y Lee",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Amide Hydrolysis.",
"metal_ions": [
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "8JV104",
"notes": "* The amide substrate was prepared by solution-phase coupling of a 3'-CO2H oligonucleotide and a 5'-amino-5'-deoxythymidine oligonucleotide. For further details, please see the supplementary material of the publication. All dT nucleotides in the catalytic region of the DNAzyme are 5'-substituted 2'-deoxyuridine derivatives (AmdU).",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "*Amide substrate embedded within DNA oligonucleotide complementary to the DNAzyme's binding arms.",
"structures": [],
"x": "",
"yield": ""
},
"950": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl ",
"e": "AGAGCGGGACTACGCAGACACGCGAATCGCTAGTACGTGG",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "C Zhou",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J L Avins, P C Klauser, B M Brandsen, Y Lee",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Amide Hydrolysis.",
"metal_ions": [
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "8JV112",
"notes": "* The amide substrate was prepared by solution-phase coupling of a 3'-CO2H oligonucleotide and a 5'-amino-5'-deoxythymidine oligonucleotide. For further details, please see the supplementary material of the publication. All dT nucleotides in the catalytic region of the DNAzyme are 5'-substituted 2'-deoxyuridine derivatives (AmdU).",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "*Amide substrate embedded within DNA oligonucleotide complementary to the DNAzyme's binding arms.",
"structures": [],
"x": "",
"yield": ""
},
"951": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl ",
"e": "AGAGCGGGGCTACGCAGTCACGCGAACCGCTAGTACGTGG",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "C Zhou",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J L Avins, P C Klauser, B M Brandsen, Y Lee",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Amide Hydrolysis.",
"metal_ions": [
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "8JV115",
"notes": "* The amide substrate was prepared by solution-phase coupling of a 3'-CO2H oligonucleotide and a 5'-amino-5'-deoxythymidine oligonucleotide. For further details, please see the supplementary material of the publication. All dT nucleotides in the catalytic region of the DNAzyme are 5'-substituted 2'-deoxyuridine derivatives (AmdU).",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "*Amide substrate embedded within DNA oligonucleotide complementary to the DNAzyme's binding arms.",
"structures": [],
"x": "",
"yield": ""
},
"952": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl ",
"e": "AGAGCGGGACTACGCAGTCCCGCGAACCGCTAGTACGTGG",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "C Zhou",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J L Avins, P C Klauser, B M Brandsen, Y Lee",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Amide Hydrolysis.",
"metal_ions": [
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "8JV119",
"notes": "* The amide substrate was prepared by solution-phase coupling of a 3'-CO2H oligonucleotide and a 5'-amino-5'-deoxythymidine oligonucleotide. For further details, please see the supplementary material of the publication. All dT nucleotides in the catalytic region of the DNAzyme are 5'-substituted 2'-deoxyuridine derivatives (AmdU).",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "*Amide substrate embedded within DNA oligonucleotide complementary to the DNAzyme's binding arms.",
"structures": [],
"x": "",
"yield": ""
},
"953": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl ",
"e": "AGAGCGGGACTACGCAGTCACGCGAATCGCAAGTACGTGG",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "C Zhou",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J L Avins, P C Klauser, B M Brandsen, Y Lee",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Amide Hydrolysis.",
"metal_ions": [
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "8JV129",
"notes": "* The amide substrate was prepared by solution-phase coupling of a 3'-CO2H oligonucleotide and a 5'-amino-5'-deoxythymidine oligonucleotide. For further details, please see the supplementary material of the publication. All dT nucleotides in the catalytic region of the DNAzyme are 5'-substituted 2'-deoxyuridine derivatives (AmdU).",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "*Amide substrate embedded within DNA oligonucleotide complementary to the DNAzyme's binding arms.",
"structures": [],
"x": "",
"yield": ""
},
"954": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl ",
"e": "AGAGCGGGACTACGCAGTCACGCGAAACGCTAGTACGTGG",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "C Zhou",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J L Avins, P C Klauser, B M Brandsen, Y Lee",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Amide Hydrolysis.",
"metal_ions": [
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "8JV133",
"notes": "* The amide substrate was prepared by solution-phase coupling of a 3'-CO2H oligonucleotide and a 5'-amino-5'-deoxythymidine oligonucleotide. For further details, please see the supplementary material of the publication. All dT nucleotides in the catalytic region of the DNAzyme are 5'-substituted 2'-deoxyuridine derivatives (AmdU).",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "*Amide substrate embedded within DNA oligonucleotide complementary to the DNAzyme's binding arms.",
"structures": [],
"x": "",
"yield": ""
},
"955": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl ",
"e": "AACGCAGAGGTTAGTACGAAGTAGTCAGCGCGGGGATTGA",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "C Zhou",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J L Avins, P C Klauser, B M Brandsen, Y Lee",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Amide Hydrolysis.",
"metal_ions": [
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "11JX109 (AmideCa1)",
"notes": "* The amide substrate was prepared by solution-phase coupling of a 3'-CO2H oligonucleotide and a 5'-amino-5'-deoxythymidine oligonucleotide. For further details, please see the supplementary material of the publication. All dT nucleotides in the catalytic region of the DNAzyme are 5'-substituted 2'-deoxyuridine derivatives (COOHdU).",
"r": "",
"rate_constant": "kobs = 0.03-0.04 h-1",
"reaction": "Amide hydrolysis",
"reported_in": "m",
"rp": "Carboxylic acid",
"s": "*Amide substrate embedded within DNA oligonucleotide complementary to the DNAzyme's binding arms.",
"structures": [],
"x": "",
"yield": "10-17"
},
"956": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl ",
"e": "AACGCAGAGGTTAGCACGAACTAGTCAGCGCGGGGATTGA",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "C Zhou",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J L Avins, P C Klauser, B M Brandsen, Y Lee",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Amide Hydrolysis.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "11JX104 (AmideCa2)",
"notes": "* The amide substrate was prepared by solution-phase coupling of a 3'-CO2H oligonucleotide and a 5'-amino-5'-deoxythymidine oligonucleotide. For further details, please see the supplementary material of the publication. All dT nucleotides in the catalytic region of the DNAzyme are 5'-substituted 2'-deoxyuridine derivatives (COOHdU).",
"r": "",
"rate_constant": "kobs = 0.03-0.04 h-1",
"reaction": "Amide hydrolysis",
"reported_in": "m",
"rp": "Carboxylic acid",
"s": "*Amide substrate embedded within DNA oligonucleotide complementary to the DNAzyme's binding arms.",
"structures": [],
"x": "",
"yield": "10-17"
},
"957": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl ",
"e": "AACGAACGAAGGACGGCATCCAGAACCGAGAACGGGTTAG",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "C Zhou",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J L Avins, P C Klauser, B M Brandsen, Y Lee",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Amide Hydrolysis.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "11JX112",
"notes": "* The amide substrate was prepared by solution-phase coupling of a 3'-CO2H oligonucleotide and a 5'-amino-5'-deoxythymidine oligonucleotide. For further details, please see the supplementary material of the publication. All dT nucleotides in the catalytic region of the DNAzyme are 5'-substituted 2'-deoxyuridine derivatives (COOHdU).",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "*Amide substrate embedded within DNA oligonucleotide complementary to the DNAzyme's binding arms.",
"structures": [],
"x": "",
"yield": ""
},
"958": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl ",
"e": "CCTGCTCGAAAGAACTGGTTACCGGAACGGGTGGGTGGCA",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "C Zhou",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J L Avins, P C Klauser, B M Brandsen, Y Lee",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Amide Hydrolysis.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "14JY110 (AmideHy1)",
"notes": "* The amide substrate was prepared by solution-phase coupling of a 3'-CO2H oligonucleotide and a 5'-amino-5'-deoxythymidine oligonucleotide. For further details, please see the supplementary material of the publication. All dT nucleotides in the catalytic region of the DNAzyme are 5'-substituted 2'-deoxyuridine derivatives (HOdU).",
"r": "",
"rate_constant": "kobs = 0.089 h-1",
"reaction": "Amide hydrolysis",
"reported_in": "m",
"rp": "Carboxylic acid",
"s": "*Amide substrate embedded within DNA oligonucleotide complementary to the DNAzyme's binding arms.",
"structures": [],
"x": "",
"yield": "40-50"
},
"959": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl ",
"e": "GCTGCCCCTTGAATCTCCCCCTCGGTGGAGAGGTTGACGA",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "C Zhou",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J L Avins, P C Klauser, B M Brandsen, Y Lee",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Amide Hydrolysis.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "14JY115 (AmideHy2)",
"notes": "* The amide substrate was prepared by solution-phase coupling of a 3'-CO2H oligonucleotide and a 5'-amino-5'-deoxythymidine oligonucleotide. For further details, please see the supplementary material of the publication. All dT nucleotides in the catalytic region of the DNAzyme are 5'-substituted 2'-deoxyuridine derivatives (HOdU).",
"r": "",
"rate_constant": "kobs = 0.084 h-1",
"reaction": "Amide hydrolysis",
"reported_in": "m",
"rp": "Carboxylic acid",
"s": "*Amide substrate embedded within DNA oligonucleotide complementary to the DNAzyme's binding arms.",
"structures": [],
"x": "",
"yield": "50-60"
},
"960": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl ",
"e": "GCTGCCCCAAAGTAGGAGAGAATAACCCCGGTCTGACGAT",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "C Zhou",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J L Avins, P C Klauser, B M Brandsen, Y Lee",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Amide Hydrolysis.",
"metal_ions": [
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "14JY121 (AmideHy3)",
"notes": "* The amide substrate was prepared by solution-phase coupling of a 3'-CO2H oligonucleotide and a 5'-amino-5'-deoxythymidine oligonucleotide. For further details, please see the supplementary material of the publication. All dT nucleotides in the catalytic region of the DNAzyme are 5'-substituted 2'-deoxyuridine derivatives (HOdU).",
"r": "",
"rate_constant": "kobs = 0.17 h-1",
"reaction": "Amide hydrolysis",
"reported_in": "m",
"rp": "Carboxylic acid",
"s": "*Amide substrate embedded within DNA oligonucleotide complementary to the DNAzyme's binding arms.",
"structures": [],
"x": "",
"yield": "20-25"
},
"961": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl ",
"e": "GCTGCCCCAAAGTAGGAGAGGATAACCCCGGTCTGACGAT",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "C Zhou",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J L Avins, P C Klauser, B M Brandsen, Y Lee",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Amide Hydrolysis.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "14JY127",
"notes": "* The amide substrate was prepared by solution-phase coupling of a 3'-CO2H oligonucleotide and a 5'-amino-5'-deoxythymidine oligonucleotide. For further details, please see the supplementary material of the publication. All dT nucleotides in the catalytic region of the DNAzyme are 5'-substituted 2'-deoxyuridine derivatives (HOdU).",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "*Amide substrate embedded within DNA oligonucleotide complementary to the DNAzyme's binding arms.",
"structures": [],
"x": "",
"yield": ""
},
"962": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl ",
"e": "GCTGCCCCAAAGTAGGAGGGAATAACCCCGGTCTGACGAT",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "C Zhou",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J L Avins, P C Klauser, B M Brandsen, Y Lee",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Amide Hydrolysis.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "14JY128",
"notes": "* The amide substrate was prepared by solution-phase coupling of a 3'-CO2H oligonucleotide and a 5'-amino-5'-deoxythymidine oligonucleotide. For further details, please see the supplementary material of the publication. All dT nucleotides in the catalytic region of the DNAzyme are 5'-substituted 2'-deoxyuridine derivatives (HOdU).",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "*Amide substrate embedded within DNA oligonucleotide complementary to the DNAzyme's binding arms.",
"structures": [],
"x": "",
"yield": ""
},
"963": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl ",
"e": "GCTGCCCCAAAGTAGGGGAGGATAACCCCGGTCTGACGAT",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "C-N bond",
"main_article_first_author": "C Zhou",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "J L Avins, P C Klauser, B M Brandsen, Y Lee",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Amide Hydrolysis.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "14JY101",
"notes": "* The amide substrate was prepared by solution-phase coupling of a 3'-CO2H oligonucleotide and a 5'-amino-5'-deoxythymidine oligonucleotide. For further details, please see the supplementary material of the publication. All dT nucleotides in the catalytic region of the DNAzyme are 5'-substituted 2'-deoxyuridine derivatives (HOdU).",
"r": "",
"rate_constant": "",
"reaction": "Amide hydrolysis",
"reported_in": "s",
"rp": "Carboxylic acid",
"s": "*Amide substrate embedded within DNA oligonucleotide complementary to the DNAzyme's binding arms.",
"structures": [],
"x": "",
"yield": ""
},
"964": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GCACCGGGTCGTACAGTCTCACCTTAGCTCGATAAGCGGAGAGATGCGAT",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored CAAYAA hexapeptide",
"length": 50,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A Sachdeva",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysts with tyrosine kinase activity.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "50",
"name": "8CK101",
"notes": "Does not discriminate among peptide substrates on the basis of the amino acid identities near the reactive tyrosine residue.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "kobs = 0.2 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "s",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "30-40"
},
"965": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GGACCGTCTCGTTAGGAAGATTACGACGCCTTCCTCATGGGCAAGCCGAT",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored CAAYAA hexapeptide",
"length": 50,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A Sachdeva",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysts with tyrosine kinase activity.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "50",
"name": "8CK105",
"notes": "Does not discriminate among peptide substrates on the basis of the amino acid identities near the reactive tyrosine residue.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "kobs = 0.27 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "m",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "70"
},
"966": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GCCAGCGGATCGATGTACCGGCACAGAAATAACAAAATAGTGGCAAAATG",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored CAAYAA hexapeptide",
"length": 50,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A Sachdeva",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysts with tyrosine kinase activity.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "50",
"name": "8CK106",
"notes": "Does not discriminate among peptide substrates on the basis of the amino acid identities near the reactive tyrosine residue.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "kobs = 0.15 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "s",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "70"
},
"967": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GGACCGTCTCGTGTGCCGTGTGTCAAACAACAATGTGGTAGGAATAAGCG",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored CAAYAA hexapeptide",
"length": 50,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A Sachdeva",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysts with tyrosine kinase activity.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "50",
"name": "8CK109",
"notes": "Does not discriminate among peptide substrates on the basis of the amino acid identities near the reactive tyrosine residue.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "kobs = 0.11 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "s",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "40-50"
},
"968": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GCACCGGGTCGAAATCTAGCGTCAGATCCGCCCGCAAAGGGGGCAAAGCG",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored CAAYAA hexapeptide",
"length": 50,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A Sachdeva",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysts with tyrosine kinase activity.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "50",
"name": "8CK116",
"notes": "Does not discriminate among peptide substrates on the basis of the amino acid identities near the reactive tyrosine residue.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "kobs = 0.30 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "s",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "50-60"
},
"969": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GCAGCGAATCGAGCGAGTCGAGCGGTTCCGAGGCAACGAGGAAGTTACCG",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored CAAYAA hexapeptide",
"length": 50,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A Sachdeva",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysts with tyrosine kinase activity.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "50",
"name": "8CK121",
"notes": "Does not discriminate among peptide substrates on the basis of the amino acid identities near the reactive tyrosine residue.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "kobs = 0.085 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "s",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "20-30"
},
"970": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GCAACGGATCGCACACGCCGACGGCGTACTAGAACTACGTAGTTGGAGCG",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored CAAYAA hexapeptide",
"length": 50,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A Sachdeva",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysts with tyrosine kinase activity.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "50",
"name": "8CK128",
"notes": "Does not discriminate among peptide substrates on the basis of the amino acid identities near the reactive tyrosine residue.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "kobs = 0.15 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "m",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "50"
},
"971": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GCACCGGGTCGAACCTGGAACAGAACAGATCGAGGGGACTCGATGTAGCG",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored CAAYAA hexapeptide",
"length": 50,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A Sachdeva",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysts with tyrosine kinase activity.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "50",
"name": "8CK129",
"notes": "Does not discriminate among peptide substrates on the basis of the amino acid identities near the reactive tyrosine residue.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "kobs = 0.10 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "s",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "10"
},
"972": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GCAACGACTCGTAACGGCTAGACCTTTAGGGCAGGGAACGCGGAATCGAT",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored CAAYAA hexapeptide",
"length": 50,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A Sachdeva",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysts with tyrosine kinase activity.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "50",
"name": "8CK133",
"notes": "Does not discriminate among peptide substrates on the basis of the amino acid identities near the reactive tyrosine residue.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "kobs = 0.15 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "s",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "10"
},
"973": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GCACCGAATCGTATCGGACGGACGGGTTGTCGGAAGCGAT",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored CAAYAA hexapeptide",
"length": 40,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A Sachdeva",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysts with tyrosine kinase activity.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "7CH102",
"notes": "Does not discriminate among peptide substrates on the basis of the amino acid identities near the reactive tyrosine residue.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "kobs = 0.12 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "m",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "60-70"
},
"974": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GGAACGTGTCGCTAAAGTCTGGCATTACCCAGAGACCTCG",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored CAAYAA hexapeptide",
"length": 40,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A Sachdeva",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysts with tyrosine kinase activity.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "7CH104",
"notes": "Does not discriminate among peptide substrates on the basis of the amino acid identities near the reactive tyrosine residue.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "kobs = 0.16 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "m",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "40-50"
},
"975": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GCACCGTTTCGATCTAAGGCTAGAAAGCAATGCGGAAGCG",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored CAAYAA hexapeptide",
"length": 40,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A Sachdeva",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysts with tyrosine kinase activity.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "7CH106",
"notes": "Does not discriminate among peptide substrates on the basis of the amino acid identities near the reactive tyrosine residue.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "kobs = 0.14 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "s",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "10-20"
},
"976": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GACGGCACGAATCGACCATAGGGCAAAAGT",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored CAAYAA hexapeptide",
"length": 30,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A Sachdeva",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysts with tyrosine kinase activity.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "30",
"name": "6CF101",
"notes": "Does not discriminate among peptide substrates on the basis of the amino acid identities near the reactive tyrosine residue.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "kobs = 0.26 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "s",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "30"
},
"977": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GCACCGATTCGCAACGTGGAGAGGAGCGAT",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored CAAYAA hexapeptide",
"length": 30,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A Sachdeva",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysts with tyrosine kinase activity.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "30",
"name": "6CF103",
"notes": "Does not discriminate among peptide substrates on the basis of the amino acid identities near the reactive tyrosine residue.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "kobs = 0.21 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "s",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "30-40"
},
"978": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GGAACGGATCGACGGTCGCTGACGTATCAG",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored CAAYAA hexapeptide",
"length": 30,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A Sachdeva",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysts with tyrosine kinase activity.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "30",
"name": "6CF125",
"notes": "Does not discriminate among peptide substrates on the basis of the amino acid identities near the reactive tyrosine residue.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "kobs = 0.19 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "s",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "10-20"
},
"979": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GACGGAACAAATCGAGTCAGAACGCAACAG",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored CAAYAA hexapeptide",
"length": 30,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A Sachdeva",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysts with tyrosine kinase activity.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "30",
"name": "6CF127",
"notes": "Does not discriminate among peptide substrates on the basis of the amino acid identities near the reactive tyrosine residue.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "kobs = 0.52 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "m",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "50-60"
},
"981": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "TGGGAGACGTGTCCAATATGAATAGCGCGCTTCCGAATCAGTTGGACGTT",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored CAAYAA hexapeptide",
"length": 50,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A Sachdeva",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysts with tyrosine kinase activity.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "50",
"name": "16EC103",
"notes": "Does not discriminate among peptide substrates on the basis of the amino acid identities near the reactive tyrosine residue.",
"r": "GTP",
"rate_constant": "kobs = 0.23 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "m",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "30-40"
},
"982": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "TCAGTCGACTTCGTGTGGCTTTGCGTTTAAAGAGGTAAGC",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "DNA-anchored CAAYAA hexapeptide",
"length": 40,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A Sachdeva",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysts with tyrosine kinase activity.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "21EB121",
"notes": "Does not discriminate among peptide substrates on the basis of the amino acid identities near the reactive tyrosine residue.",
"r": "GTP",
"rate_constant": "",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "m",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"983": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GTAGGGGGGACCGTAGCTTCAGCGTGACAG",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored CAAYAA hexapeptide",
"length": 30,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A Sachdeva",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysts with tyrosine kinase activity.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "30",
"name": "8EA101",
"notes": "Does not discriminate among peptide substrates on the basis of the amino acid identities near the reactive tyrosine residue.",
"r": "GTP",
"rate_constant": "kobs = 0.23 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "m",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "40-50"
},
"984": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GTGAACGGCACAATATTAATATTTGCGACATCTGGAAGGC",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored CADPYDQS octapeptide",
"length": 40,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "S N Konecki",
"main_article_pub_date": "2015",
"main_article_title": "Identification of Sequence-Selective Tyrosine Kinase Deoxyribozymes.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "TyrKinA1",
"notes": "The peptide sequence dependence was examined in detail. Peptide sequence motifs that are compatible with DNAzyme catalyzed kinase activity are DPYD, DPY, and YD.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "kobs = 0.11 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "m",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "60"
},
"985": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GTACCAATTGAGGAGGCGGGCTCGTCACGAAATAGTGACG",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored CADPYDQS octapeptide",
"length": 40,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "S N Konecki",
"main_article_pub_date": "2015",
"main_article_title": "Identification of Sequence-Selective Tyrosine Kinase Deoxyribozymes.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "TyrKinA2",
"notes": "The peptide sequence dependence was examined in detail. Peptide sequence motifs that are compatible with DNAzyme catalyzed kinase activity are DPYD, DPY, and YD.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "kobs = 0.08 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "m",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "30-40"
},
"986": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GTGGGCGACGATACCAAGGTCAGGACCCTGGTAGAGCCGC",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored CADPYDQS octapeptide",
"length": 40,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "S N Konecki",
"main_article_pub_date": "2015",
"main_article_title": "Identification of Sequence-Selective Tyrosine Kinase Deoxyribozymes.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "TyrKinA3",
"notes": "The peptide sequence dependence was examined in detail. Motifs could not be assigned with confidence due to the low reaction yields.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "kobs = 0.05 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "m",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "<10"
},
"987": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GGTGGCACATACCAGATCCGGTGCCCACCAGGATGGGTTCCCGAGTGAATAAGACAGTAGGCTACCACAGAAACGAGACG",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored CADPYDQS octapeptide",
"length": 80,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "S N Konecki",
"main_article_pub_date": "2015",
"main_article_title": "Identification of Sequence-Selective Tyrosine Kinase Deoxyribozymes.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "80",
"name": "TyrKinB1",
"notes": "The peptide sequence dependence was examined in detail. Peptide sequence motifs that are compatible with DNAzyme catalyzed kinase activity are DPYD, DPY, and YD.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "kobs = 0.05 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "m",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "30-40"
},
"988": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GTGGAAGCGCACGTTCACCGCAAATGCCCCAGATTCCCCCAGATATCGTAGCCGTGGATGGTGAACAAGCGTGTCAAGTA",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored CADPYDQS octapeptide",
"length": 80,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "S N Konecki",
"main_article_pub_date": "2015",
"main_article_title": "Identification of Sequence-Selective Tyrosine Kinase Deoxyribozymes.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "80",
"name": "TyrKinB2",
"notes": "The peptide sequence dependence was examined in detail. Motifs could not be assigned with confidence due to the low reaction yields.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "kobs = 0.06 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "m",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "<10"
},
"989": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "TGGGCGAAGTAAGCTTCTCAGGGGTGCACTGCACCGGTTC",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "DNA-anchored CMTGYVAT octapeptide",
"length": 40,
"linkage": "",
"main_article_first_author": "S M Walsh",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "S N Konecki",
"main_article_pub_date": "2015",
"main_article_title": "Identification of Sequence-Selective Tyrosine Kinase Deoxyribozymes.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "TyrKinC1",
"notes": "The peptide sequence dependence was examined in detail. This DNAzyme has partial selectivity with regard to peptide sequence.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "m",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"990": {
"buffer": "50 mM HEPES pH 7.5, 40 mM MgCl2, 20 mM, MnCl2, 150 mM NaCl, 2 mM KC",
"e": "GACTGCGGGAGCGGTGAGCGGGTAGGTCTACATGAGGGCT",
"fg1s": [
"Phosphorylated amino acid"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored AAAXAA hexapeptide",
"length": 40,
"linkage": "",
"main_article_first_author": "A Sachdeva",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "M Chandra, J Chandrasekar",
"main_article_pub_date": "2012",
"main_article_title": "Covalent tagging of phosphorylated peptides by phosphate-specific deoxyribozymes.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "8VM1",
"notes": "The 8VM1 and 8VP1 deoxyribozymes covalently modify phosphotyrosine and phosphoserine.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "kobs = 0.37 h-1",
"reaction": "Covalent Modification of Phosphorylated Amino Acid Side Chains",
"reported_in": "m",
"rp": "",
"s": "",
"structures": [],
"x": "X = phosphotyrosine (YP) or phosphoserine (SP)",
"yield": "50-60"
},
"991": {
"buffer": "50 mM HEPES pH 7.5, 40 mM MgCl2, 20 mM, MnCl2, 150 mM NaCl, 2 mM KC",
"e": "GGACACGATGAGTGACTAAGTGGAATGAGGAAAGCACGAG",
"fg1s": [
"Phosphorylated amino acid"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "DNA-anchored AAAXAA hexapeptide",
"length": 40,
"linkage": "",
"main_article_first_author": "A Sachdeva",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "M Chandra, J Chandrasekar",
"main_article_pub_date": "2012",
"main_article_title": "Covalent tagging of phosphorylated peptides by phosphate-specific deoxyribozymes.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "8VP1",
"notes": "The 8VM1 and 8VP1 deoxyribozymes covalently modify phosphotyrosine and phosphoserine.",
"r": "5\u2032-triphosphorylated RNA oligonucleotide",
"rate_constant": "kobs = 0.15 h-1",
"reaction": "Covalent Modification of Phosphorylated Amino Acid Side Chains",
"reported_in": "m",
"rp": "",
"s": "",
"structures": [],
"x": "X = phosphotyrosine (YP) or phosphoserine (SP)",
"yield": "40"
},
"992": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "TGAGCCCTTGCGAGAGACATGGGTCAGGACGGACAGAGGG",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"ATP"
],
"kinetics": "y",
"l": "DNA-anchored CAAYAA hexapeptide",
"length": 40,
"linkage": "",
"main_article_first_author": "V Dokukin",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2014",
"main_article_title": "A modular tyrosine kinase deoxyribozyme with discrete aptamer and catalyst domains.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "14JS101",
"notes": "14JS101 is a modular tyrosine kinase deoxyribozyme, in which the ATP aptamer domain binds the small-molecule ATP substrate and the initially random (N40) region is responsible for catalysis.",
"r": "ATP",
"rate_constant": "kobs = 0.21 h-1",
"reaction": "Tyrosine Phosphorylation",
"reported_in": "m",
"rp": "Phosphotyrosine",
"s": "",
"structures": [],
"x": "",
"yield": "50-60"
},
"993": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "ACAGGTGGCGGATGTAGTTTACCCGTTTTCTGTAGAGCC",
"fg1s": [
"Phosphoserine"
],
"fg2s": [],
"kinetics": "y",
"l": "DNA-anchored AAAXAA hexapeptide",
"length": 39,
"linkage": "",
"main_article_first_author": "J Chandrasekar",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A C Wylder",
"main_article_pub_date": "2015",
"main_article_title": "Phosphoserine Lyase Deoxyribozymes: DNA-Catalyzed Formation of Dehydroalanine Residues in Peptides.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "DhaDz1",
"notes": "",
"r": "",
"rate_constant": "kobs = 0.28 h-1",
"reaction": "Covalent Modification of Phosphorylated Amino Acid Side Chains",
"reported_in": "m",
"rp": "Dehydroalanine",
"s": "",
"structures": [],
"x": "X = phosphoserine (SP)",
"yield": "80"
},
"994": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "ACAGGATTCAAAGTGGCTGTCAGAAGTTGGTGAGGGAAG",
"fg1s": [
"Phosphoserine"
],
"fg2s": [],
"kinetics": "y",
"l": "DNA-anchored AAAXAA hexapeptide",
"length": 39,
"linkage": "",
"main_article_first_author": "J Chandrasekar",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "A C Wylder",
"main_article_pub_date": "2015",
"main_article_title": "Phosphoserine Lyase Deoxyribozymes: DNA-Catalyzed Formation of Dehydroalanine Residues in Peptides.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "DhaDz2",
"notes": "",
"r": "",
"rate_constant": "kobs = 0.43 h-1",
"reaction": "Covalent Modification of Phosphorylated Amino Acid Side Chains",
"reported_in": "m",
"rp": "Dehydroalanine",
"s": "",
"structures": [],
"x": "X = phosphoserine (SP)",
"yield": "68"
},
"1013": {
"buffer": "70 mM HEPES pH 7.5, 150 mM NaCl, 1 mM ZnCl2, 40 mM MgCl2",
"e": "CCCACACCATATACAAGGGAAGATGGGGCGTCCGAGGGCT",
"fg1s": [],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "",
"main_article_first_author": "V Dokukin",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2012",
"main_article_title": "Lanthanide ions as required cofactors for DNA catalysts",
"metal_ions": [
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6YF2",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "deglycosylated DNA",
"s": "CTACCTTTATGCGTATCGAAGGAGGCTTTCGgga",
"structures": [],
"x": "",
"yield": ""
},
"1014": {
"buffer": "70 mM HEPES pH 7.5, 150 mM NaCl, 1 mM ZnCl2, 40 mM MgCl2",
"e": "AAGCCGGAATAGCCGATGAGGCGCCAGAGAAGTCCCCCGT",
"fg1s": [],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "",
"main_article_first_author": "V Dokukin",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2012",
"main_article_title": "Lanthanide ions as required cofactors for DNA catalysts",
"metal_ions": [
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6YF13",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "deglycosylated DNA",
"s": "CTACCTTTATGCGTATCGAAGGAGGCTTTCGgga",
"structures": [],
"x": "",
"yield": ""
},
"1015": {
"buffer": "70 mM HEPES pH 7.5, 150 mM NaCl, 1 mM ZnCl2, 40 mM MgCl2",
"e": "GTCGCAGCCCGACGGGGTCTACCGGAGTGCATGTGGCGGG",
"fg1s": [],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "",
"main_article_first_author": "V Dokukin",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2012",
"main_article_title": "Lanthanide ions as required cofactors for DNA catalysts",
"metal_ions": [
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6YF15",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "deglycosylated DNA",
"s": "CTACCTTTATGCGTATCGAAGGAGGCTTTCGgga",
"structures": [],
"x": "",
"yield": ""
},
"1016": {
"buffer": "70 mM HEPES pH 7.5, 150 mM NaCl, 1 mM ZnCl2, 40 mM MgCl2",
"e": "CCCACCTCAAATGTTGTATGAGCAAGAGACGTCCGAGGGT",
"fg1s": [],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "",
"main_article_first_author": "V Dokukin",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2012",
"main_article_title": "Lanthanide ions as required cofactors for DNA catalysts",
"metal_ions": [
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6YF16",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "deglycosylated DNA",
"s": "CTACCTTTATGCGTATCGAAGGAGGCTTTCGgga",
"structures": [],
"x": "",
"yield": ""
},
"1017": {
"buffer": "70 mM HEPES pH 7.5, 150 mM NaCl, 1 mM ZnCl2, 40 mM MgCl2",
"e": "CCCACTGTGCCAATGCGCCATGGCAACAACGTCCGAGGGC",
"fg1s": [],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "",
"main_article_first_author": "V Dokukin",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2012",
"main_article_title": "Lanthanide ions as required cofactors for DNA catalysts",
"metal_ions": [
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6YF20",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "deglycosylated DNA",
"s": "CTACCTTTATGCGTATCGAAGGAGGCTTTCGgga",
"structures": [],
"x": "",
"yield": ""
},
"1018": {
"buffer": "70 mM HEPES pH 7.5, 150 mM NaCl, 1 mM ZnCl2, 40 mM MgCl2",
"e": "CCCAGATCGGCAACGGGTCGTTCACGATGCCTACGAGGGT",
"fg1s": [],
"fg2s": [],
"kinetics": "n",
"l": "",
"length": 40,
"linkage": "",
"main_article_first_author": "V Dokukin",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2012",
"main_article_title": "Lanthanide ions as required cofactors for DNA catalysts",
"metal_ions": [
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6YF27",
"notes": "",
"r": "",
"rate_constant": "",
"reaction": "DNA cleavage",
"reported_in": "s",
"rp": "deglycosylated DNA",
"s": "CTACCTTTATGCGTATCGAAGGAGGCTTTCGgga",
"structures": [],
"x": "",
"yield": ""
},
"1031": {
"buffer": "50 mM CHES pH 9.0 with 40 mM MgCl2, 150 mM NaCl",
"e": "AGCAGCAATATGTCGCGGTATAGAGAGGATTGACTTGCGT",
"fg1s": [
"aliphatic amino group"
],
"fg2s": [
"5\u2032-phosphorimidazolide"
],
"kinetics": "y",
"l": "DNA-C3-NH2",
"length": 40,
"linkage": "phosphoramidate (P\u2013N) linkage",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T E Velez, A Sachdeva, N A Ibrahim",
"main_article_pub_date": "2014",
"main_article_title": "DNA-catalyzed lysine side chain modification.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "7DX107",
"notes": "",
"r": "5\u2032-phosphorimidazolide-activated DNA oligonucleotide",
"rate_constant": "kobs = 0.03 h-1",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1032": {
"buffer": "50 mM CHES pH 9.0 with 40 mM MgCl2, 150 mM NaCl",
"e": "AGGGGCGGAAACAGATAGAACGAGAGAGTGCGTCCCCGTA",
"fg1s": [
"aliphatic amino group"
],
"fg2s": [
"5\u2032-phosphorimidazolide"
],
"kinetics": "n",
"l": "DNA-C3-NH2",
"length": 40,
"linkage": "phosphoramidate (P\u2013N) linkage",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T E Velez, A Sachdeva, N A Ibrahim",
"main_article_pub_date": "2014",
"main_article_title": "DNA-catalyzed lysine side chain modification.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "7DX108",
"notes": "",
"r": "5\u2032-phosphorimidazolide-activated DNA oligonucleotide",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1033": {
"buffer": "50 mM CHES pH 9.0 with 40 mM MgCl2, 150 mM NaCl",
"e": "AGTGGTGCGCGTCACCCAACGCCAAAAGCGCTGTAACATA",
"fg1s": [
"aliphatic amino group"
],
"fg2s": [
"5\u2032-phosphorimidazolide"
],
"kinetics": "n",
"l": "DNA-C3-NH2",
"length": 40,
"linkage": "phosphoramidate (P\u2013N) linkage",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T E Velez, A Sachdeva, N A Ibrahim",
"main_article_pub_date": "2014",
"main_article_title": "DNA-catalyzed lysine side chain modification.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "7DX110",
"notes": "",
"r": "5\u2032-phosphorimidazolide-activated DNA oligonucleotide",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1034": {
"buffer": "50 mM CHES pH 9.0 with 40 mM MgCl2, 150 mM NaCl",
"e": "ATAGTGAGTCGTGTGTGACGCAAAAATTCGGATTCGAAAG",
"fg1s": [
"aliphatic amino group"
],
"fg2s": [
"5\u2032-phosphorimidazolide"
],
"kinetics": "n",
"l": "DNA-C3-NH2",
"length": 40,
"linkage": "phosphoramidate (P\u2013N) linkage",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T E Velez, A Sachdeva, N A Ibrahim",
"main_article_pub_date": "2014",
"main_article_title": "DNA-catalyzed lysine side chain modification.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "7DX111",
"notes": "",
"r": "5\u2032-phosphorimidazolide-activated DNA oligonucleotide",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1035": {
"buffer": "50 mM CHES pH 9.0 with 40 mM MgCl2, 150 mM NaCl",
"e": "AGAAACTGGGACACCGACGCCGAAGATCCACTAGAACATA",
"fg1s": [
"aliphatic amino group"
],
"fg2s": [
"5\u2032-phosphorimidazolide"
],
"kinetics": "n",
"l": "DNA-C3-NH2",
"length": 40,
"linkage": "phosphoramidate (P\u2013N) linkage",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T E Velez, A Sachdeva, N A Ibrahim",
"main_article_pub_date": "2014",
"main_article_title": "DNA-catalyzed lysine side chain modification.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "7DX112",
"notes": "",
"r": "5\u2032-phosphorimidazolide-activated DNA oligonucleotide",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1036": {
"buffer": "50 mM CHES pH 9.0 with 40 mM MgCl2, 150 mM NaCl",
"e": "AGGGCAGTGAAGGACAAGTGTCAAGAGCCTGGTGGCCCGT",
"fg1s": [
"aliphatic amino group"
],
"fg2s": [
"5\u2032-phosphorimidazolide"
],
"kinetics": "n",
"l": "DNA-C3-NH2",
"length": 40,
"linkage": "phosphoramidate (P\u2013N) linkage",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T E Velez, A Sachdeva, N A Ibrahim",
"main_article_pub_date": "2014",
"main_article_title": "DNA-catalyzed lysine side chain modification.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "7DX114",
"notes": "",
"r": "5\u2032-phosphorimidazolide-activated DNA oligonucleotide",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1037": {
"buffer": "50 mM CHES pH 9.0 with 40 mM MgCl2, 150 mM NaCl",
"e": "ACGGGAAGCGACGAAGGCTTCAAGAAGGGACTAGGACATA",
"fg1s": [
"aliphatic amino group"
],
"fg2s": [
"5\u2032-phosphorimidazolide"
],
"kinetics": "n",
"l": "DNA-C3-NH2",
"length": 40,
"linkage": "phosphoramidate (P\u2013N) linkage",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T E Velez, A Sachdeva, N A Ibrahim",
"main_article_pub_date": "2014",
"main_article_title": "DNA-catalyzed lysine side chain modification.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "7DX124",
"notes": "",
"r": "5\u2032-phosphorimidazolide-activated DNA oligonucleotide",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1040": {
"buffer": "50 mM CHES pH 9.0 with 40 mM MgCl2, 150 mM NaCl",
"e": "AGCGAGCGGCATGATGTCGAACATCGATCATTATGTGTGA",
"fg1s": [
"Lysine's amino"
],
"fg2s": [
"5\u2032-phosphorimidazolide"
],
"kinetics": "y",
"l": "DNA-HEG-CKA tripeptide",
"length": 40,
"linkage": "phosphoramidate (P\u2013N) linkage",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T E Velez, A Sachdeva, N A Ibrahim",
"main_article_pub_date": "2014",
"main_article_title": "DNA-catalyzed lysine side chain modification.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "14DV103",
"notes": "",
"r": "5\u2032-phosphorimidazolide-activated DNA oligonucleotide",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1041": {
"buffer": "50 mM CHES pH 9.0 with 40 mM MgCl2, 150 mM NaCl",
"e": "AGCGAGCGACGTAGCGTGTTAAACACAACCCTACGTGTGA",
"fg1s": [
"Lysine's amino"
],
"fg2s": [
"5\u2032-phosphorimidazolide"
],
"kinetics": "n",
"l": "DNA-HEG-CKA tripeptide",
"length": 40,
"linkage": "phosphoramidate (P\u2013N) linkage",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T E Velez, A Sachdeva, N A Ibrahim",
"main_article_pub_date": "2014",
"main_article_title": "DNA-catalyzed lysine side chain modification.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "14DV104",
"notes": "",
"r": "5\u2032-phosphorimidazolide-activated DNA oligonucleotide",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1042": {
"buffer": "50 mM CHES pH 9.0 with 40 mM MgCl2, 150 mM NaCl",
"e": "AGCGAGCGGCGGAGTTGGATGATTTACCAATAACGCGTGA",
"fg1s": [
"Lysine's amino"
],
"fg2s": [
"5\u2032-phosphorimidazolide"
],
"kinetics": "n",
"l": "DNA-HEG-CKA tripeptide",
"length": 40,
"linkage": "phosphoramidate (P\u2013N) linkage",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T E Velez, A Sachdeva, N A Ibrahim",
"main_article_pub_date": "2014",
"main_article_title": "DNA-catalyzed lysine side chain modification.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "14DV108",
"notes": "",
"r": "5\u2032-phosphorimidazolide-activated DNA oligonucleotide",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1043": {
"buffer": "50 mM CHES pH 9.0 with 40 mM MgCl2, 150 mM NaCl",
"e": "AGCGAGCGACACCGGCCAGCAATCGGAAGATGGTGTGTGA",
"fg1s": [
"Lysine's amino"
],
"fg2s": [
"5\u2032-phosphorimidazolide"
],
"kinetics": "n",
"l": "DNA-HEG-CKA tripeptide",
"length": 40,
"linkage": "phosphoramidate (P\u2013N) linkage",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T E Velez, A Sachdeva, N A Ibrahim",
"main_article_pub_date": "2014",
"main_article_title": "DNA-catalyzed lysine side chain modification.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "14DV111",
"notes": "",
"r": "5\u2032-phosphorimidazolide-activated DNA oligonucleotide",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1044": {
"buffer": "50 mM CHES pH 9.0 with 40 mM MgCl2, 150 mM NaCl",
"e": "AGCGAGCGACGGGAGATCATTTTACATGATAAACGTGTGA",
"fg1s": [
"Lysine's amino"
],
"fg2s": [
"5\u2032-phosphorimidazolide"
],
"kinetics": "n",
"l": "DNA-HEG-CKA tripeptide",
"length": 40,
"linkage": "phosphoramidate (P\u2013N) linkage",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T E Velez, A Sachdeva, N A Ibrahim",
"main_article_pub_date": "2014",
"main_article_title": "DNA-catalyzed lysine side chain modification.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "14DV117",
"notes": "",
"r": "5\u2032-phosphorimidazolide-activated DNA oligonucleotide",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1045": {
"buffer": "50 mM CHES pH 9.0 with 40 mM MgCl2, 150 mM NaCl",
"e": "AGCGAGCGGAACGTGCCAGCCGTCGTAGGGACGTTCGTGA",
"fg1s": [
"Lysine's amino"
],
"fg2s": [
"5\u2032-phosphorimidazolide"
],
"kinetics": "n",
"l": "DNA-HEG-CKA tripeptide",
"length": 40,
"linkage": "phosphoramidate (P\u2013N) linkage",
"main_article_first_author": "B M Brandsen",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "T E Velez, A Sachdeva, N A Ibrahim",
"main_article_pub_date": "2014",
"main_article_title": "DNA-catalyzed lysine side chain modification.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "14DV131",
"notes": "",
"r": "5\u2032-phosphorimidazolide-activated DNA oligonucleotide",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1051": {
"buffer": "70 mM HEPES pH 7.5, 40 mM MgCl2, 20 mM MnCl2, 1 mM ZnCl2, 150 mM NaCl",
"e": "GGGAGATGTCTCTCAGACGGAAACTTTCAGTACGGAATGG",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "Azido-AYA peptide",
"length": 40,
"linkage": "",
"main_article_first_author": "C Chu",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "O Y Wong",
"main_article_pub_date": "2014",
"main_article_title": "A generalizable DNA-catalyzed approach to peptide-nucleic acid conjugation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "8XJ105",
"notes": "",
"r": "5\u2032-triphosphate-RNA",
"rate_constant": "kobs = 0.41 h-1",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": "45"
},
"1054": {
"buffer": "70 mM HEPES pH 7.5, 40 mM MgCl2, 20 mM MnCl2, 1 mM ZnCl2, 150 mM NaCl",
"e": "GTCGCCAGTCTCTGCTGCCTTGGTCATCAACCTTTCTGTC",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "Azido-GPYSGN peptide",
"length": 40,
"linkage": "",
"main_article_first_author": "C Chu",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "O Y Wong",
"main_article_pub_date": "2014",
"main_article_title": "A generalizable DNA-catalyzed approach to peptide-nucleic acid conjugation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "11EM103",
"notes": "",
"r": "5\u2032-triphosphate-RNA",
"rate_constant": "kobs = 0.34 h-1",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": "60"
},
"1055": {
"buffer": "70 mM HEPES pH 7.5, 40 mM MgCl2, 20 mM MnCl2, 1 mM ZnCl2, 150 mM NaCl",
"e": "TGTGGGCCGTAAATCGCTTGCGGTGCTTTTTGGATGGGGT",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5\u2032-phosphorimidazolide"
],
"kinetics": "y",
"l": "Azido-AYA peptide",
"length": 40,
"linkage": "",
"main_article_first_author": "C Chu",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "O Y Wong",
"main_article_pub_date": "2014",
"main_article_title": "A generalizable DNA-catalyzed approach to peptide-nucleic acid conjugation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "11EP101",
"notes": "",
"r": "5\u2032-phosphorimidazolide-activated DNA oligonucleotide",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1056": {
"buffer": "70 mM HEPES pH 7.5, 40 mM MgCl2, 20 mM MnCl2, 1 mM ZnCl2, 150 mM NaCl",
"e": "AGGTTGGGGGCGTAGTTGCTTTTGGGCGAATATGCTTGGC",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5\u2032-phosphorimidazolide"
],
"kinetics": "y",
"l": "Azido-AYA peptide",
"length": 40,
"linkage": "",
"main_article_first_author": "C Chu",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "O Y Wong",
"main_article_pub_date": "2014",
"main_article_title": "A generalizable DNA-catalyzed approach to peptide-nucleic acid conjugation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "11EP103",
"notes": "",
"r": "5\u2032-phosphorimidazolide-activated DNA oligonucleotide",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1057": {
"buffer": "70 mM HEPES pH 7.5, 40 mM MgCl2, 20 mM MnCl2, 1 mM ZnCl2, 150 mM NaCl",
"e": "GGGAGTAGGGCCTGGGGCACTTGCGGCCCGTGAGACAGCA",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5\u2032-phosphorimidazolide"
],
"kinetics": "y",
"l": "Azido-AYA peptide",
"length": 40,
"linkage": "",
"main_article_first_author": "C Chu",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "O Y Wong",
"main_article_pub_date": "2014",
"main_article_title": "A generalizable DNA-catalyzed approach to peptide-nucleic acid conjugation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "11EP104",
"notes": "",
"r": "5\u2032-phosphorimidazolide-activated DNA oligonucleotide",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1058": {
"buffer": "70 mM HEPES pH 7.5, 40 mM MgCl2, 20 mM MnCl2, 1 mM ZnCl2, 150 mM NaCl",
"e": "GGAGTCCTGTTTGAGTCGGCTATCCCGTTAATGGCGGGTA",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5\u2032-phosphorimidazolide"
],
"kinetics": "y",
"l": "Azido-AYA peptide",
"length": 40,
"linkage": "",
"main_article_first_author": "C Chu",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "O Y Wong",
"main_article_pub_date": "2014",
"main_article_title": "A generalizable DNA-catalyzed approach to peptide-nucleic acid conjugation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "11EP111",
"notes": "",
"r": "5\u2032-phosphorimidazolide-activated DNA oligonucleotide",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1059": {
"buffer": "70 mM HEPES pH 7.5, 40 mM MgCl2, 20 mM MnCl2, 1 mM ZnCl2, 150 mM NaCl",
"e": "GGCTGTTGGCTCATCATATTATGATTGAGTTCGATGTCGG",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5\u2032-phosphorimidazolide"
],
"kinetics": "y",
"l": "Azido-AYA peptide",
"length": 40,
"linkage": "",
"main_article_first_author": "C Chu",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "O Y Wong",
"main_article_pub_date": "2014",
"main_article_title": "A generalizable DNA-catalyzed approach to peptide-nucleic acid conjugation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "11EP119",
"notes": "",
"r": "5\u2032-phosphorimidazolide-activated DNA oligonucleotide",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1060": {
"buffer": "70 mM HEPES pH 7.5, 40 mM MgCl2, 20 mM MnCl2, 1 mM ZnCl2, 150 mM NaCl",
"e": "AGGTTGGGGGCGTTACTGCTTAATGTGATTCAATTGGCAT",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5\u2032-phosphorimidazolide"
],
"kinetics": "y",
"l": "Azido-AYA peptide",
"length": 40,
"linkage": "",
"main_article_first_author": "C Chu",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "O Y Wong",
"main_article_pub_date": "2014",
"main_article_title": "A generalizable DNA-catalyzed approach to peptide-nucleic acid conjugation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "11EP126",
"notes": "",
"r": "5\u2032-phosphorimidazolide-activated DNA oligonucleotide",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "s",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1061": {
"buffer": "70 mM HEPES pH 7.5, 40 mM MgCl2, 20 mM MnCl2, 1 mM ZnCl2, 150 mM NaCl",
"e": "TCGGGGAATCGTGGGTGGCCCAAATGTGTTAATGAAGAAG",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"5\u2032-phosphorimidazolide"
],
"kinetics": "y",
"l": "Azido-AYA peptide",
"length": 40,
"linkage": "",
"main_article_first_author": "C Chu",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "O Y Wong",
"main_article_pub_date": "2014",
"main_article_title": "A generalizable DNA-catalyzed approach to peptide-nucleic acid conjugation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "11EP125",
"notes": "",
"r": "5\u2032-phosphorimidazolide-activated DNA oligonucleotide",
"rate_constant": "",
"reaction": "Covalent Modification of Amino Acid Side Chains",
"reported_in": "m",
"rp": "nucleopeptide linkage",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1062": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "CGCTAGATACGTGAATGTGTTTGACAGAGCCGGTCATCAA",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D J Parker",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Xiao, J M Aguilar",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysis of a normally disfavored RNA hydrolysis reaction.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6SE3",
"notes": "Partially randomized catalytic region based on 10MD5 sequence",
"r": "",
"rate_constant": "kobs = 0.11 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "",
"s": "AAAGTCTCATGTACTTATATXTTCTAGCGCgga",
"structures": [],
"x": "riboG",
"yield": ""
},
"1063": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "CGATAGATAACGGGGTGGATTTGCAACCGCAGTACATATA",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D J Parker",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Xiao, J M Aguilar",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysis of a normally disfavored RNA hydrolysis reaction.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6SE10",
"notes": "Partially randomized catalytic region based on 10MD5 sequence",
"r": "",
"rate_constant": "kobs = 1,38 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "",
"s": "AAAGTCTCATGTACTTATATXTTCTAGCGCgga",
"structures": [],
"x": "riboG",
"yield": "80-90"
},
"1064": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GGCTAGAGAAGCGAGTGTGTTTGCTACAACGGGCCGTTAA",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D J Parker",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Xiao, J M Aguilar",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysis of a normally disfavored RNA hydrolysis reaction.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6SE11",
"notes": "Partially randomized catalytic region based on 10MD5 sequence",
"r": "",
"rate_constant": "kobs = 0.027 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "",
"s": "AAAGTCTCATGTACTTATATXTTCTAGCGCgga",
"structures": [],
"x": "riboG",
"yield": ""
},
"1065": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "CGATAGATACGTAGGAGCGTTAGCTATAGCCGTACATAGA",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D J Parker",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Xiao, J M Aguilar",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysis of a normally disfavored RNA hydrolysis reaction.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6SE12",
"notes": "Partially randomized catalytic region based on 10MD5 sequence",
"r": "",
"rate_constant": "kobs = 0.10 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "",
"s": "AAAGTCTCATGTACTTATATXTTCTAGCGCgga",
"structures": [],
"x": "riboG",
"yield": ""
},
"1066": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GGCCATATAACTCGGAGAGTTTCCTAGAGCTGTGCGTGAA",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D J Parker",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Xiao, J M Aguilar",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysis of a normally disfavored RNA hydrolysis reaction.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6SE15",
"notes": "Partially randomized catalytic region based on 10MD5 sequence",
"r": "",
"rate_constant": "kobs = 0.055 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "",
"s": "AAAGTCTCATGTACTTATATXTTCTAGCGCgga",
"structures": [],
"x": "riboG",
"yield": ""
},
"1067": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GGCTAGAGCAGCGGGTGTGTTTGCTATACCCGGCCCTATA",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D J Parker",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Xiao, J M Aguilar",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysis of a normally disfavored RNA hydrolysis reaction.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6SE20",
"notes": "Partially randomized catalytic region based on 10MD5 sequence",
"r": "",
"rate_constant": "kobs = 0.53 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "",
"s": "AAAGTCTCATGTACTTATATXTTCTAGCGCgga",
"structures": [],
"x": "riboG",
"yield": "80-90"
},
"1068": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GGCTAGGGAAGCGGCTACGTACACCTCAGCGGGCACATAA",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D J Parker",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Xiao, J M Aguilar",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysis of a normally disfavored RNA hydrolysis reaction.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6SE22",
"notes": "Partially randomized catalytic region based on 10MD5 sequence",
"r": "",
"rate_constant": "kobs = 0.19 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "",
"s": "AAAGTCTCATGTACTTATATXTTCTAGCGCgga",
"structures": [],
"x": "riboG",
"yield": ""
},
"1069": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GGCTAGAGAAGCGGATGAGTTTCCTATAGATATCCGGCCA",
"fg1s": [
"2'-OH"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D J Parker",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Xiao, J M Aguilar",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysis of a normally disfavored RNA hydrolysis reaction.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "6SE30",
"notes": "Partially randomized catalytic region based on 10MD5 sequence",
"r": "",
"rate_constant": "kobs = 0.38 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "",
"s": "AAAGTCTCATGTACTTATATXTTCTAGCGCgga",
"structures": [],
"x": "riboG",
"yield": "80-90"
},
"1070": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "CGCTAGATAAGTGGGCGCGTTTGCTGTAGTTGTCCTACGA",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D J Parker",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Xiao, J M Aguilar",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysis of a normally disfavored RNA hydrolysis reaction.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "9SE20",
"notes": "Partially randomized catalytic region based on 10MD5 sequence",
"r": "",
"rate_constant": "kobs = 0.12 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "hydrolyzed RNA",
"s": "AAAGTCTCATGTACTTATATXTTCTAGCGCgga",
"structures": [],
"x": "riboG",
"yield": ""
},
"1071": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "CGCTAGATAAGTGGATGCGTTTGCTGTAGTTGTCCTTCAA",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D J Parker",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Xiao, J M Aguilar",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysis of a normally disfavored RNA hydrolysis reaction.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "9SE22",
"notes": "Partially randomized catalytic region based on 10MD5 sequence",
"r": "",
"rate_constant": "kobs = 0.018 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "hydrolyzed RNA",
"s": "AAAGTCTCATGTACTTATATXTTCTAGCGCgga",
"structures": [],
"x": "riboG",
"yield": ""
},
"1072": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "CGCCAGATAAGTGGAGGCTTTTGCTAGAGTTGTCCTTTAA",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D J Parker",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Xiao, J M Aguilar",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysis of a normally disfavored RNA hydrolysis reaction.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "9SE23",
"notes": "Partially randomized catalytic region based on 10MD5 sequence",
"r": "",
"rate_constant": "kobs = 0.051 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "hydrolyzed RNA",
"s": "AAAGTCTCATGTACTTATATXTTCTAGCGCgga",
"structures": [],
"x": "riboG",
"yield": ""
},
"1073": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "CGCCAGATAAGTGGAGACTTTTGCTATAGTTGTCCTTGTA",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D J Parker",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Xiao, J M Aguilar",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysis of a normally disfavored RNA hydrolysis reaction.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "9SE33",
"notes": "Partially randomized catalytic region based on 10MD5 sequence",
"r": "",
"rate_constant": "kobs = 0.071 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "hydrolyzed RNA",
"s": "AAAGTCTCATGTACTTATATXTTCTAGCGCgga",
"structures": [],
"x": "riboG",
"yield": "70-80"
},
"1074": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "CCCTATACAAGTGGGAGGATTAGCCATAGGCGTGGGGCAA",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D J Parker",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Xiao, J M Aguilar",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysis of a normally disfavored RNA hydrolysis reaction.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "9SH2",
"notes": "Partially randomized catalytic region based on 10MD5 sequence",
"r": "",
"rate_constant": "kobs = 0.087 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "hydrolyzed RNA",
"s": "AAAGUCUCAUGUACUUAUAUGUUCUAGCGCGGA",
"structures": [],
"x": "",
"yield": "80-90"
},
"1075": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GGCTAGAATAGTGGGGGCGATTGATCTAGGGGGCGCTTAA",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D J Parker",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Xiao, J M Aguilar",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysis of a normally disfavored RNA hydrolysis reaction.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "9SH3",
"notes": "Partially randomized catalytic region based on 10MD5 sequence",
"r": "",
"rate_constant": "kobs = 0.12 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "hydrolyzed RNA",
"s": "AAAGUCUCAUGUACUUAUAUGUUCUAGCGCGGA",
"structures": [],
"x": "",
"yield": ""
},
"1076": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "CCCTAGATAAGGGGGTGCGTATTCTTTGGGTGCCCCGAAA",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D J Parker",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Xiao, J M Aguilar",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysis of a normally disfavored RNA hydrolysis reaction.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "9SH5",
"notes": "Partially randomized catalytic region based on 10MD5 sequence",
"r": "",
"rate_constant": "kobs = 0.032 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "hydrolyzed RNA",
"s": "AAAGUCUCAUGUACUUAUAUGUUCUAGCGCGGA",
"structures": [],
"x": "",
"yield": ""
},
"1077": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "AGGCAGAAAAGTGGGTACTCTTGTTAGAGCTCTACATATA",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D J Parker",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Xiao, J M Aguilar",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysis of a normally disfavored RNA hydrolysis reaction.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "9SH18",
"notes": "Partially randomized catalytic region based on 10MD5 sequence",
"r": "",
"rate_constant": "kobs = 0.022 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "hydrolyzed RNA",
"s": "AAAGUCUCAUGUACUUAUAUGUUCUAGCGCGGA",
"structures": [],
"x": "",
"yield": ""
},
"1078": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "CGCCCGTTGGCAGGGTGCGCTTGTTATCGTTGTCCTGCAG",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D J Parker",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Xiao, J M Aguilar",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysis of a normally disfavored RNA hydrolysis reaction.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "9SH25",
"notes": "Partially randomized catalytic region based on 10MD5 sequence",
"r": "",
"rate_constant": "kobs = 0.026 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "hydrolyzed RNA",
"s": "AAAGUCUCAUGUACUUAUAUGUUCUAGCGCGGA",
"structures": [],
"x": "",
"yield": ""
},
"1079": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GGAGAGCTCGTGTGTGAGAGCATTAAGTGAACTGACTGGT",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D J Parker",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Xiao, J M Aguilar",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysis of a normally disfavored RNA hydrolysis reaction.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "9SK1",
"notes": "",
"r": "",
"rate_constant": "kobs = 0.82 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "hydrolyzed RNA",
"s": "AAAGUCUCAUGUACUUAUAUGUUCUAGCGCGGA",
"structures": [],
"x": "",
"yield": "70-80"
},
"1080": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "TACGGACGGGGCGTAGCGGATTGAACTGCAGAGCAGAGTG",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D J Parker",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Xiao, J M Aguilar",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysis of a normally disfavored RNA hydrolysis reaction.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "9SK2",
"notes": "",
"r": "",
"rate_constant": "kobs = 0.10 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "hydrolyzed RNA",
"s": "AAAGUCUCAUGUACUUAUAUGUUCUAGCGCGGA",
"structures": [],
"x": "",
"yield": "80"
},
"1081": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GGGGCAGTAGGAGGTTAGGCCAGGGAGAGAGGAAGGTAGG",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D J Parker",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Xiao, J M Aguilar",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysis of a normally disfavored RNA hydrolysis reaction.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "9SK5",
"notes": "",
"r": "",
"rate_constant": "kobs = 1.19 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "hydrolyzed RNA",
"s": "AAAGUCUCAUGUACUUAUAUGUUCUAGCGCGGA",
"structures": [],
"x": "",
"yield": "70-80"
},
"1082": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GCCAGCGATCAAAGACGGCGAGTTGTACCCATAGGTGTCT",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D J Parker",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Xiao, J M Aguilar",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysis of a normally disfavored RNA hydrolysis reaction.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "9SK17",
"notes": "",
"r": "",
"rate_constant": "kobs = 0.71 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "hydrolyzed RNA",
"s": "AAAGUCUCAUGUACUUAUAUGUUCUAGCGCGGA",
"structures": [],
"x": "",
"yield": "80-90"
},
"1083": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "GAGAGTGTACGGTTACGCACTAGCTAACAGGAGTTCGTGC",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D J Parker",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Xiao, J M Aguilar",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysis of a normally disfavored RNA hydrolysis reaction.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "9SK29",
"notes": "",
"r": "",
"rate_constant": "kobs = 0.15 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "hydrolyzed RNA",
"s": "AAAGUCUCAUGUACUUAUAUGUUCUAGCGCGGA",
"structures": [],
"x": "",
"yield": ""
},
"1084": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "CCGGGCTGCGAAGTTGGCGATAAGCTACCGTAGGACGCTT",
"fg1s": [
"H2O"
],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "D J Parker",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "Y Xiao, J M Aguilar",
"main_article_pub_date": "2013",
"main_article_title": "DNA catalysis of a normally disfavored RNA hydrolysis reaction.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "9SK31",
"notes": "",
"r": "",
"rate_constant": "kobs = 0.061 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "hydrolyzed RNA",
"s": "AAAGUCUCAUGUACUUAUAUGUUCUAGCGCGGA",
"structures": [],
"x": "",
"yield": ""
},
"1085": {
"buffer": "70\u2005mm HEPES pH\u20057.5, 1\u2005mm ZnCl2, 20\u2005mm MnCl2, 40\u2005mm MgCl2, 150\u2005mm NaCl",
"e": "AACCACCTTTGTATAGTTGGGGGGCGGGCCACCGTGACAC",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"2\u2032\u2010Az\u2010dATP"
],
"kinetics": "y",
"l": "DNA-anchored CAAYAA hexapeptide",
"length": 40,
"linkage": "phosphodiester",
"main_article_first_author": "P Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Introduction of Azide at Tyrosine for Peptide Modification.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "DzAz1",
"notes": "DzAz1 retains substantial activity when natural ATP is used in place of 2\u2032\u2010Az\u2010dATP.",
"r": "2\u2032\u2010Az\u2010dATP",
"rate_constant": "kobs = 0.79 h-1",
"reaction": "Tyrosine azido\u2010adenylylation",
"reported_in": "m",
"rp": "Azido-adenylated peptide",
"s": "",
"structures": [],
"x": "",
"yield": "40"
},
"1086": {
"buffer": "70\u2005mm HEPES pH\u20057.5, 1\u2005mm ZnCl2, 20\u2005mm MnCl2, 40\u2005mm MgCl2, 150\u2005mm NaCl",
"e": "ACCCTTCACAGCAAACAAGGGGGGCGGGCCACCGTGACCC",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"2\u2032\u2010Az\u2010dATP"
],
"kinetics": "y",
"l": "DNA-anchored CAAYAA hexapeptide",
"length": 40,
"linkage": "phosphodiester",
"main_article_first_author": "P Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Introduction of Azide at Tyrosine for Peptide Modification.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "DzAz1b",
"notes": "Reselected starting from DzAz1",
"r": "2\u2032\u2010Az\u2010dATP",
"rate_constant": "kobs = 0.38 h-1",
"reaction": "Tyrosine azido\u2010adenylylation",
"reported_in": "m",
"rp": "Azido-adenylated peptide",
"s": "",
"structures": [],
"x": "",
"yield": "58"
},
"1087": {
"buffer": "70\u2005mm HEPES pH\u20057.5, 1\u2005mm ZnCl2, 20\u2005mm MnCl2, 40\u2005mm MgCl2, 150\u2005mm NaCl",
"e": "AAGCACCAATGCGATGGACGGGGGCGGGCCACCGTGACAC",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"2\u2032\u2010Az\u2010dATP"
],
"kinetics": "y",
"l": "DNA-anchored CAAYAA hexapeptide",
"length": 40,
"linkage": "phosphodiester",
"main_article_first_author": "P Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Introduction of Azide at Tyrosine for Peptide Modification.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "DzAz1c",
"notes": "Reselected starting from DzAz1",
"r": "2\u2032\u2010Az\u2010dATP",
"rate_constant": "kobs = 0.19 h-1",
"reaction": "Tyrosine azido\u2010adenylylation",
"reported_in": "m",
"rp": "Azido-adenylated peptide",
"s": "",
"structures": [],
"x": "",
"yield": "56"
},
"1088": {
"buffer": "70\u2005mm HEPES pH\u20057.5, 1\u2005mm ZnCl2, 20\u2005mm MnCl2, 40\u2005mm MgCl2, 150\u2005mm NaCl",
"e": "GCACATACCGAATCAGAGCGGTGGCCAGGACATGAGATAA",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"2\u2032\u2010Az\u2010dATP"
],
"kinetics": "y",
"l": "DNA-anchored CLQTYPRT octapeptide",
"length": 40,
"linkage": "phosphodiester",
"main_article_first_author": "P Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Introduction of Azide at Tyrosine for Peptide Modification.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "DzAz2",
"notes": "Natural ATP is generally tolerated well in place of 2\u2032\u2010Az\u2010dATP.",
"r": "2\u2032\u2010Az\u2010dATP",
"rate_constant": "kobs = 0.14 h-1",
"reaction": "Tyrosine azido\u2010adenylylation",
"reported_in": "m",
"rp": "Azido-adenylated peptide",
"s": "",
"structures": [],
"x": "",
"yield": "70-80"
},
"1089": {
"buffer": "70\u2005mm HEPES pH\u20057.5, 1\u2005mm ZnCl2, 20\u2005mm MnCl2, 40\u2005mm MgCl2, 150\u2005mm NaCl",
"e": "CCAACATAGGATGAGGAAGGGTAGGGACTTCCCGTGACTG",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"2\u2032\u2010Az\u2010dATP"
],
"kinetics": "y",
"l": "DNA-anchored CLQTYPRT octapeptide",
"length": 40,
"linkage": "phosphodiester",
"main_article_first_author": "P Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Introduction of Azide at Tyrosine for Peptide Modification.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "DzAz3",
"notes": "Natural ATP is generally tolerated well in place of 2\u2032\u2010Az\u2010dATP.",
"r": "2\u2032\u2010Az\u2010dATP",
"rate_constant": "",
"reaction": "Tyrosine azido\u2010adenylylation",
"reported_in": "s",
"rp": "Azido-adenylated peptide",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1090": {
"buffer": "70\u2005mm HEPES pH\u20057.5, 1\u2005mm ZnCl2, 20\u2005mm MnCl2, 40\u2005mm MgCl2, 150\u2005mm NaCl",
"e": "CGAACACACGTGGAGGTCGAGTTCGAATGTTTGATCGGTA",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"2\u2032\u2010Az\u2010dATP"
],
"kinetics": "y",
"l": "DNA-anchored CLQTYPRT octapeptide",
"length": 40,
"linkage": "phosphodiester",
"main_article_first_author": "P Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Introduction of Azide at Tyrosine for Peptide Modification.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "DzAz4",
"notes": "Natural ATP is generally tolerated well in place of 2\u2032\u2010Az\u2010dATP.",
"r": "2\u2032\u2010Az\u2010dATP",
"rate_constant": "",
"reaction": "Tyrosine azido\u2010adenylylation",
"reported_in": "s",
"rp": "Azido-adenylated peptide",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1091": {
"buffer": "70\u2005mm HEPES pH\u20057.5, 1\u2005mm ZnCl2, 20\u2005mm MnCl2, 40\u2005mm MgCl2, 150\u2005mm NaCl",
"e": "GATGCGACTCGTCGTACGTAGGGGTAGGGATCCCCGTGAC",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"2\u2032\u2010Az\u2010dATP"
],
"kinetics": "y",
"l": "DNA-anchored CLQTYPRT octapeptide",
"length": 40,
"linkage": "phosphodiester",
"main_article_first_author": "P Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Introduction of Azide at Tyrosine for Peptide Modification.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "DzAz5",
"notes": "Natural ATP is generally tolerated well in place of 2\u2032\u2010Az\u2010dATP.",
"r": "2\u2032\u2010Az\u2010dATP",
"rate_constant": "",
"reaction": "Tyrosine azido\u2010adenylylation",
"reported_in": "s",
"rp": "Azido-adenylated peptide",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1092": {
"buffer": "70\u2005mm HEPES pH\u20057.5, 1\u2005mm ZnCl2, 20\u2005mm MnCl2, 40\u2005mm MgCl2, 150\u2005mm NaCl",
"e": "GTGTCCTAGTAAGAGTGATGGGGGTAGGGACCCCCGCGAC",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"2\u2032\u2010Az\u2010dATP"
],
"kinetics": "y",
"l": "DNA-anchored CLQTYPRT octapeptide",
"length": 40,
"linkage": "phosphodiester",
"main_article_first_author": "P Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Introduction of Azide at Tyrosine for Peptide Modification.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "DzAz6",
"notes": "Natural ATP is generally tolerated well in place of 2\u2032\u2010Az\u2010dATP.",
"r": "2\u2032\u2010Az\u2010dATP",
"rate_constant": "",
"reaction": "Tyrosine azido\u2010adenylylation",
"reported_in": "s",
"rp": "Azido-adenylated peptide",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1093": {
"buffer": "70\u2005mm HEPES pH\u20057.5, 1\u2005mm ZnCl2, 20\u2005mm MnCl2, 40\u2005mm MgCl2, 150\u2005mm NaCl",
"e": "GCATACTGTTAGGGCTACAGATATACGTATATCTGCGCTA",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"2\u2032\u2010Az\u2010dATP"
],
"kinetics": "y",
"l": "DNA-anchored CQQPYITN octapeptide",
"length": 40,
"linkage": "phosphodiester",
"main_article_first_author": "P Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Introduction of Azide at Tyrosine for Peptide Modification.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "DzAz7",
"notes": "Natural ATP is generally tolerated well in place of 2\u2032\u2010Az\u2010dATP.",
"r": "2\u2032\u2010Az\u2010dATP",
"rate_constant": "kobs = 0.24 h-1",
"reaction": "Tyrosine azido\u2010adenylylation",
"reported_in": "m",
"rp": "Azido-adenylated peptide",
"s": "",
"structures": [],
"x": "",
"yield": "61"
},
"1094": {
"buffer": "70\u2005mm HEPES pH\u20057.5, 1\u2005mm ZnCl2, 20\u2005mm MnCl2, 40\u2005mm MgCl2, 150\u2005mm NaCl",
"e": "ATCGTCTCTAACTCTGGGGGCATAGGGCTGCCCGTGACTA",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"2\u2032\u2010Az\u2010dATP"
],
"kinetics": "y",
"l": "DNA-anchored CERSYLMK octapeptide",
"length": 40,
"linkage": "phosphodiester",
"main_article_first_author": "P Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Introduction of Azide at Tyrosine for Peptide Modification.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "DzAz8",
"notes": "Natural ATP is generally tolerated well in place of 2\u2032\u2010Az\u2010dATP.",
"r": "2\u2032\u2010Az\u2010dATP",
"rate_constant": "kobs = 0.46 h-1",
"reaction": "Tyrosine azido\u2010adenylylation",
"reported_in": "m",
"rp": "Azido-adenylated peptide",
"s": "",
"structures": [],
"x": "",
"yield": "87"
},
"1095": {
"buffer": "70\u2005mm HEPES pH\u20057.5, 1\u2005mm ZnCl2, 20\u2005mm MnCl2, 40\u2005mm MgCl2, 150\u2005mm NaCl",
"e": "AGCCCCTTACGCAGAAATAGAGAGGGGCGGGTCCCGTGAC",
"fg1s": [
"Tyrosine's hydroxyl"
],
"fg2s": [
"2\u2032\u2010Az\u2010dATP"
],
"kinetics": "y",
"l": "DNA-anchored CFQPYMQE octapeptide",
"length": 40,
"linkage": "phosphodiester",
"main_article_first_author": "P Wang",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2016",
"main_article_title": "DNA-Catalyzed Introduction of Azide at Tyrosine for Peptide Modification.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "DzAz9",
"notes": "Natural ATP is generally tolerated well in place of 2\u2032\u2010Az\u2010dATP.",
"r": "2\u2032\u2010Az\u2010dATP",
"rate_constant": "",
"reaction": "Tyrosine azido\u2010adenylylation",
"reported_in": "s",
"rp": "Azido-adenylated peptide",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1096": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "AGGTGAGCCGTATTATTCAAGGTGTTACTAGGCGGGAGTT",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "n",
"l": "DTME",
"length": 40,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "40",
"name": "DAR2",
"notes": "",
"r": "DNA-HEG-anthracene",
"rate_constant": "",
"reaction": "Diels-Alder",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1097": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "AGGGGAGTGAGTCGCTAGCATGATAGATGAACGGGGGTGA",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "n",
"l": "DTME",
"length": 40,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "40",
"name": "DAR3",
"notes": "",
"r": "DNA-HEG-anthracene",
"rate_constant": "",
"reaction": "Diels-Alder",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1098": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "GACCAATGCGAGGTGAGTCGTTCCAACCACGATGGGAGTG",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "n",
"l": "DTME",
"length": 40,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "40",
"name": "DAR4",
"notes": "",
"r": "DNA-HEG-anthracene",
"rate_constant": "",
"reaction": "Diels-Alder",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1099": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "AGGGGAGTGAGTCGCAAGCATGATAGATGAACGGGGGTG",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "n",
"l": "DTME",
"length": 39,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "40",
"name": "DAR10",
"notes": "",
"r": "DNA-HEG-anthracene",
"rate_constant": "",
"reaction": "Diels-Alder",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1100": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "AGGGGAGTCGTAATTATTCGAACGGGGGTG",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "n",
"l": "DTME",
"length": 30,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "40",
"name": "DAR12",
"notes": "",
"r": "DNA-HEG-anthracene",
"rate_constant": "",
"reaction": "Diels-Alder",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1101": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "CATTAGCGACAGGGTGTTGGGGTGGGTGTATTATCGGGAT",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "n",
"l": "DTME",
"length": 40,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "40",
"name": "DAR14",
"notes": "",
"r": "DNA-HEG-anthracene",
"rate_constant": "",
"reaction": "Diels-Alder",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1102": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "GGGCGAGGTGAGCCGTGAAAGAATATTATAGGCGGGAGTG",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "n",
"l": "DTME",
"length": 40,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "40",
"name": "DAR17",
"notes": "",
"r": "DNA-HEG-anthracene",
"rate_constant": "",
"reaction": "Diels-Alder",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1103": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "GTCGAATTATCCAGTATGAACGACGGGAACGGGGTGGGCT",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "n",
"l": "DTME",
"length": 40,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "40",
"name": "DAR22",
"notes": "",
"r": "DNA-HEG-anthracene",
"rate_constant": "",
"reaction": "Diels-Alder",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1104": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "TAGGTGAGACGGATTAGCTACGTAAAAATCCGCGGGAGTG",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "n",
"l": "DTME",
"length": 40,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "40",
"name": "DAR23",
"notes": "",
"r": "DNA-HEG-anthracene",
"rate_constant": "",
"reaction": "Diels-Alder",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1105": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "GACCAATGCGAGGTGAGTCGTTTTAACCACGACGGGAGTT",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "n",
"l": "DTME",
"length": 40,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "40",
"name": "DAR24",
"notes": "",
"r": "DNA-HEG-anthracene",
"rate_constant": "",
"reaction": "Diels-Alder",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1106": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "TCGAAGCGGTTCCAGTAAGTCGTAGTAAGTCTCGTC",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "n",
"l": "DTME",
"length": 36,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "*",
"name": "DAB5",
"notes": "Partially randomized catalytic region based on the 39M49 ribozyme, synthesized as DNA.",
"r": "DNA-HEG-anthracene",
"rate_constant": "",
"reaction": "Diels-Alder",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1107": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "ACGAGGAATACTCGTTGACGGGAGTAGGGGTGGGG",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "n",
"l": "DTME",
"length": 35,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "*",
"name": "DAB6",
"notes": "Partially randomized catalytic region based on the 39M49 ribozyme, synthesized as DNA.",
"r": "DNA-HEG-anthracene",
"rate_constant": "",
"reaction": "Diels-Alder",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1108": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "AGGGGGATGTTCGGATTGTCCGGGGAATACCTAGG",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "n",
"l": "DTME",
"length": 35,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "*",
"name": "DAB7",
"notes": "Partially randomized catalytic region based on the 39M49 ribozyme, synthesized as DNA.",
"r": "DNA-HEG-anthracene",
"rate_constant": "",
"reaction": "Diels-Alder",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1109": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "AGGGGGATGTTCGGATTGTCCGGGGAATACTAGCC",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "n",
"l": "DTME",
"length": 35,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "*",
"name": "DAB8",
"notes": "Partially randomized catalytic region based on the 39M49 ribozyme, synthesized as DNA.",
"r": "DNA-HEG-anthracene",
"rate_constant": "",
"reaction": "Diels-Alder",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1110": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "ACGAGGAATACTCGTTGACGGGAGTAGGGGTGGGG",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "n",
"l": "DTME",
"length": 35,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "*",
"name": "DAB9",
"notes": "Partially randomized catalytic region based on the 39M49 ribozyme, synthesized as DNA.",
"r": "DNA-HEG-anthracene",
"rate_constant": "",
"reaction": "Diels-Alder",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1111": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "CAGAGGCTGTGACGGGACTTGGGGGTGGGAGTCGTT",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "n",
"l": "DTME",
"length": 36,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "*",
"name": "DAB10",
"notes": "Partially randomized catalytic region based on the 39M49 ribozyme, synthesized as DNA.",
"r": "DNA-HEG-anthracene",
"rate_constant": "",
"reaction": "Diels-Alder",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1112": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "TCAAGACAGGGCAAGGGGTGGGGTCGAATGATCAAT",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "n",
"l": "DTME",
"length": 36,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "*",
"name": "DAB12",
"notes": "Partially randomized catalytic region based on the 39M49 ribozyme, synthesized as DNA.",
"r": "DNA-HEG-anthracene",
"rate_constant": "",
"reaction": "Diels-Alder",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1113": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "TCAAGACAGGGCAAGGGGTGGGGTCGAATGATCAAT",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "n",
"l": "DTME",
"length": 36,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "*",
"name": "DAB13",
"notes": "Partially randomized catalytic region based on the 39M49 ribozyme, synthesized as DNA.",
"r": "DNA-HEG-anthracene",
"rate_constant": "",
"reaction": "Diels-Alder",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1114": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "ACTGGGTCGTATTACCTTTTGAGGGCAACCCCCCGA",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "n",
"l": "DTME",
"length": 36,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "*",
"name": "DAB18",
"notes": "Partially randomized catalytic region based on the 39M49 ribozyme, synthesized as DNA.",
"r": "DNA-HEG-anthracene",
"rate_constant": "",
"reaction": "Diels-Alder",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1115": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "TCAAGACAGGGCAAGGGGTGGGGTCGAATGATCAAT",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "n",
"l": "DTME",
"length": 36,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "*",
"name": "DAB19",
"notes": "Partially randomized catalytic region based on the 39M49 ribozyme, synthesized as DNA.",
"r": "DNA-HEG-anthracene",
"rate_constant": "",
"reaction": "Diels-Alder",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1116": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "GGCGAGGTGAGGCGACCTCATAGGAGCGGGAGTGGGC",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "n",
"l": "DTME",
"length": 37,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "*",
"name": "DAB20",
"notes": "Partially randomized catalytic region based on the 39M49 ribozyme, synthesized as DNA.",
"r": "DNA-HEG-anthracene",
"rate_constant": "",
"reaction": "Diels-Alder",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1117": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "GTGAGCTCGTGGCAGGTCGTAGGTGCAAGCCCCCAC",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "y",
"l": "DTME",
"length": 36,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "*",
"name": "DAB22",
"notes": "Partially randomized catalytic region based on the 39M49 ribozyme, synthesized as DNA.",
"r": "DNA-HEG-anthracene",
"rate_constant": "kobs = 4 min-1",
"reaction": "Diels-Alder",
"reported_in": "m",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": "80-90"
},
"1118": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "ACGAGGAATACTCGTTGACGGGAGTAGGGGTGGGG",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "n",
"l": "DTME",
"length": 35,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "*",
"name": "DAB23",
"notes": "Partially randomized catalytic region based on the 39M49 ribozyme, synthesized as DNA.",
"r": "DNA-HEG-anthracene",
"rate_constant": "",
"reaction": "Diels-Alder",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1119": {
"buffer": "50 mM Tris pH 7.5, 200 mM NaCl, 100 mM KCl, 20 mM MgCl2, 20 mM CaCl2, 5 \u00b5M MnCl2, 5 \u00b5M CoCl2, 5 \u00b5M CuCl2, 5 \u00b5M ZnCl2,",
"e": "GTCAGACAGGGACAGGGGTGGGGAGCATTATTCGTC",
"fg1s": [
"Anthracene"
],
"fg2s": [
"DTME (dithiobismaleimidoethane)"
],
"kinetics": "n",
"l": "DTME",
"length": 36,
"linkage": "",
"main_article_first_author": "M Chandra",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "",
"main_article_pub_date": "2008",
"main_article_title": "DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Zn2+",
"Ca2+",
"Cu2+",
"Co2+"
],
"n": "*",
"name": "DAB24",
"notes": "Partially randomized catalytic region based on the 39M49 ribozyme, synthesized as DNA.",
"r": "DNA-HEG-anthracene",
"rate_constant": "",
"reaction": "Diels-Alder",
"reported_in": "s",
"rp": "",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1121": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "TAAGGGAGGTACGATACACGCCACTTGCACGTTGTGGCGA",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "",
"main_article_first_author": "Y Lee",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "P C Klauser, B M Brandsen, C Zhou, X Li",
"main_article_pub_date": "2017",
"main_article_title": "DNA-Catalyzed DNA Cleavage by a Radical Pathway with Well-Defined Products.",
"metal_ions": [
"Mg2+",
"Zn2+"
],
"n": "40",
"name": "RadDz3",
"notes": "This DNAzyme catalyzes a radical-based reaction pathway that results in excision of most atoms of a specific guanosine nucleoside.",
"r": "",
"rate_constant": "kobs = 0.20 h-1",
"reaction": "DNA cleavage",
"reported_in": "m",
"rp": "",
"s": "GGATAATACGACTCACTATTTGAAGAGATGGCGACTTCG",
"structures": [],
"x": "",
"yield": "50-60"
},
"1122": {
"buffer": "70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl",
"e": "TAAGATAAACACACCGGCCGTCACGCTGCCTCAGACGGTGAGTGACCCTAAAATAAGGGGATAACCCAAGGCCGATATCCCAATTTGAGATGGTCGGGGA",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 100,
"linkage": "",
"main_article_first_author": "Y Lee",
"main_article_last_autor": "S K Silverman",
"main_article_mid_authors": "P C Klauser, B M Brandsen, C Zhou, X Li",
"main_article_pub_date": "2017",
"main_article_title": "DNA-Catalyzed DNA Cleavage by a Radical Pathway with Well-Defined Products.",
"metal_ions": [
"Mg2+",
"Zn2+"
],
"n": "100",
"name": "RadDz6",
"notes": "This DNAzyme catalyzes a radical-based reaction pathway that results in excision of most atoms of a specific guanosine nucleoside.",
"r": "",
"rate_constant": "kobs = 1 h-1",
"reaction": "DNA cleavage",
"reported_in": "m",
"rp": "",
"s": "GGATAATACGACTCACTATTTGAAGAGATGGCGACTTCG",
"structures": [],
"x": "",
"yield": "40"
},
"1123": {
"buffer": "10 mM MgCl2, 150 mM NaCl, 1 mM spermine, 0.01% SDS, 50 mM Hepes pH 7.5",
"e": "TGGCGACTACAAAGATATTCTCGGGCAGTTAATGCTTATTGATATCTC",
"fg1s": [],
"fg2s": [],
"kinetics": "y",
"l": "",
"length": 48,
"linkage": "",
"main_article_first_author": "T L Sheppard",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "P Ordoukhanian",
"main_article_pub_date": "2000",
"main_article_title": "A DNA enzyme with N-glycosylase activity.",
"metal_ions": [
"Mn2+",
"Mg2+",
"Ca2+",
"Ba2+"
],
"n": "*",
"name": "10-28",
"notes": "The original goal of the in vitro selection was to select for an O-glycosidase DNA enzyme that could cleave a target disaccharide, instead, N-glycosylase activity emerged. ",
"r": "",
"rate_constant": "kobs = 0.2 min-1",
"reaction": "DNA depurination",
"reported_in": "m",
"rp": "Cleavage of the N-glycosidic bond of residue G17",
"s": "GAGCTACGTTTTTTTGGAAGAGATGGCGACTACAA",
"structures": [],
"x": "",
"yield": ""
},
"1124": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM alachlor, 10% methanol ",
"e": "GGAGACAGGTTCCGGATGCATG",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "9Q1",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1125": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM alachlor, 10% methanol ",
"e": "GGAGATAGGTTCCAGCTGATTG",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "9Q2",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1126": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM alachlor, 10% methanol ",
"e": "GGACCGATGGAGTGAACTATGC",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "9Q5",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1127": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM alachlor, 10% methanol ",
"e": "ACGGACAGTTTCCGGAGCCGTG",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "9Q9",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1128": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM atrazine, 10% methanol",
"e": "GGTACGGGGCGTGCGGAGGCAC",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "9R2a",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1129": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM atrazine, 10% methanol",
"e": "GGTTCGGGGTATGCGGAGGCAT",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "9R2b",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1130": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM atrazine, 10% methanol",
"e": "GGACCGATGGAGTGAACTATGC",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "9R4a",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1131": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM atrazine, 10% methanol",
"e": "GGACCATGTTGGAGCGGCCCAG",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "9R6",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1132": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM atrazine, 10% methanol",
"e": "GGACCATGGGGGAGCGGCCCGC",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "9R7",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1133": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM atrazine, 10% methanol",
"e": "GGAGGATCGGACAGCGTTATCG",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "9R16b",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1134": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM atrazine, 10% methanol",
"e": "GGAGCGACACACAGACCTGTTC",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "y",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "9R20",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "kobs = 0.133 h-1",
"reaction": "RNA ligation",
"reported_in": "m",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": "70"
},
"1135": {
"buffer": "50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM KCl, 40 mM MgCl2, 20 mM MnCl2, 1 mM alachlor, 10% methanol ",
"e": "GGAGGATCGTACAGCGTTATCG",
"fg1s": [
"2',3 '- diol"
],
"fg2s": [
"5'-triphosphate"
],
"kinetics": "n",
"l": "GGAACUGCGAUCUAGUGA",
"length": 22,
"linkage": "3',5'",
"main_article_first_author": "A K Behera",
"main_article_last_autor": "A Baum",
"main_article_mid_authors": "K J Schlund, A J Mason, K O Alila, M Han, R L GroutD",
"main_article_pub_date": "2013",
"main_article_title": "Enhanced deoxyribozyme\u2010catalyzed RNA ligation in the presence of organic cosolvents",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "22",
"name": "10Q7b",
"notes": "In vitro selections aim at identifying RNA-ligating deoxyribozymes that depend on a target herbicide for activity. The selections denoted 'Q' used alachlor, while the selection denoted 'R' used atrazine.",
"r": "GACUGACUCGUGAUCGGA",
"rate_constant": "",
"reaction": "RNA ligation",
"reported_in": "s",
"rp": "native RNA",
"s": "",
"structures": [],
"x": "",
"yield": ""
},
"1382": {
"buffer": "1\u2009M NaCl, 50\u2009mM Tris-HCl pH 7.5, 10\u2009mM MgCl2",
"e": "TGTTTCTCGCTTTGCTGGATGTACTTTT",
"fg1s": [
"2'-OH of rU"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 28,
"linkage": "RNA phosphodiester",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "H Yu",
"main_article_mid_authors": "J Yang, X Yuan, J Cao, J Xu, J C Chaput, Z Li",
"main_article_pub_date": "2019",
"main_article_title": "A Novel Small RNA-Cleaving Deoxyribozyme with a Short Binding Arm",
"metal_ions": [
"Mg2+"
],
"n": "50",
"name": "10-12",
"notes": "",
"r": "",
"rate_constant": null,
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "AAAAGUAACUAGAGAUGG",
"structures": [],
"x": "",
"yield": null
},
"1383": {
"buffer": "1\u2009M NaCl, 50\u2009mM Tris-HCl pH 7.5, 10\u2009mM MgCl2",
"e": "CATTTCTCGCTTTGCTGGATGTTACTTTT",
"fg1s": [
"2'-OH of rU"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 29,
"linkage": "RNA phosphodiester",
"main_article_first_author": "Y Wang",
"main_article_last_autor": "H Yu",
"main_article_mid_authors": "J Yang, X Yuan, J Cao, J Xu, J C Chaput, Z Li",
"main_article_pub_date": "2019",
"main_article_title": "A Novel Small RNA-Cleaving Deoxyribozyme with a Short Binding Arm",
"metal_ions": [
"Mg2+"
],
"n": "*",
"name": "10-12opt",
"notes": "Optimization of 10\u201312 catalytic core for improved activity.",
"r": "",
"rate_constant": "kobs = 0.015 min-1 and 0.0027 min-1 towards RNA substrates with UU and UA cleavage site junctions, respectively.",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "AAAAGUAACUAGAGAUGG",
"structures": [],
"x": "",
"yield": null
},
"1829": {
"buffer": "70 mM HEPES pH 8.0, 40 mM MgCl2, 0.001% Tween-20",
"e": "GAACCAGGTCGGGGCCGAAATATAGGATATTTTGGGAGGCTATGCTAGG",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 49,
"linkage": "RNA phosphodiester",
"main_article_first_author": "W Chiuman",
"main_article_last_autor": "Y Li",
"main_article_mid_authors": "",
"main_article_pub_date": "2007",
"main_article_title": "Simple fluorescent sensors engineered with catalytic DNA 'MgZ' based on a non-classic allosteric design.",
"metal_ions": [
"Mg2+"
],
"n": "60",
"name": "MgZ",
"notes": "Resulting from the reselection of MgZ-5.",
"r": "",
"rate_constant": "kc = 1 min-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "ACTCTTCCTAGCFrAQGGTTCGATCAAGA",
"structures": [],
"x": "Fluorescein (F)- and a DABCYL (Q)-modified deoxyribothymidine. ",
"yield": "91"
},
"1830": {
"buffer": "10 mM Mg2+, pH 7.5",
"e": "TCAAAGAGTCGAATGAGGGGGTCGCTGGGTTCTGGGGCGGGATCTATTCGAGTAAGGGGGAGTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 64,
"linkage": "RNA phosphodiester",
"main_article_first_author": "W Chiuman",
"main_article_last_autor": "Y Li",
"main_article_mid_authors": "",
"main_article_pub_date": "2007",
"main_article_title": "Simple fluorescent sensors engineered with catalytic DNA 'MgZ' based on a non-classic allosteric design.",
"metal_ions": [
"Mg2+"
],
"n": "60",
"name": "MgZ-1",
"notes": "",
"r": "",
"rate_constant": null,
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "specific cleavage at desired position",
"s": "cleavage in cis",
"structures": [],
"x": "Fluorescein (F)- and a DABCYL (Q)-modified deoxyribothymidine. ",
"yield": null
},
"1831": {
"buffer": "10 mM Mg2+, pH 7.5",
"e": "TCAAAGAGTCGAATGAGGGGGTCGCTGGGTTCTGGGGCGTGATTCATTTGAGTAAGGGGGGGTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 64,
"linkage": "RNA phosphodiester",
"main_article_first_author": "W Chiuman",
"main_article_last_autor": "Y Li",
"main_article_mid_authors": "",
"main_article_pub_date": "2007",
"main_article_title": "Simple fluorescent sensors engineered with catalytic DNA 'MgZ' based on a non-classic allosteric design.",
"metal_ions": [
"Mg2+"
],
"n": "60",
"name": "MgZ-3",
"notes": "",
"r": "",
"rate_constant": null,
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "specific cleavage at desired position",
"s": "cleavage in cis",
"structures": [],
"x": "Fluorescein (F)- and a DABCYL (Q)-modified deoxyribothymidine. ",
"yield": null
},
"1832": {
"buffer": "10 mM Mg2+, pH 7.5",
"e": "TCAAAGAGTCGAATGAGGGGGTCGCTGGGTTCTGGGGCGGGATTCATTCGAGTAAGGGGGGGTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 64,
"linkage": "RNA phosphodiester",
"main_article_first_author": "W Chiuman",
"main_article_last_autor": "Y Li",
"main_article_mid_authors": "",
"main_article_pub_date": "2007",
"main_article_title": "Simple fluorescent sensors engineered with catalytic DNA 'MgZ' based on a non-classic allosteric design.",
"metal_ions": [
"Mg2+"
],
"n": "60",
"name": "MgZ-4",
"notes": "",
"r": "",
"rate_constant": null,
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "specific cleavage at desired position",
"s": "cleavage in cis",
"structures": [],
"x": "Fluorescein (F)- and a DABCYL (Q)-modified deoxyribothymidine. ",
"yield": null
},
"1833": {
"buffer": "10 mM Mg2+, pH 7.5",
"e": "TCAAGAGTCGAATGAGGGGGTCGCTGGGTTCTGGGGCGGGATTCATTCGAGTAAGGGGGAGTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 63,
"linkage": "RNA phosphodiester",
"main_article_first_author": "W Chiuman",
"main_article_last_autor": "Y Li",
"main_article_mid_authors": "",
"main_article_pub_date": "2007",
"main_article_title": "Simple fluorescent sensors engineered with catalytic DNA 'MgZ' based on a non-classic allosteric design.",
"metal_ions": [
"Mg2+"
],
"n": "60",
"name": "MgZ-6",
"notes": "",
"r": "",
"rate_constant": null,
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "specific cleavage at desired position",
"s": "cleavage in cis",
"structures": [],
"x": "Fluorescein (F)- and a DABCYL (Q)-modified deoxyribothymidine. ",
"yield": null
},
"1834": {
"buffer": "10 mM Mg2+, pH 7.5",
"e": "TCAAAGAGTTGAATGAGGGGGTCGCTGGGTTCTGGGGCGGGATTCATTCGAGTAGGGGGGGTA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 63,
"linkage": "RNA phosphodiester",
"main_article_first_author": "W Chiuman",
"main_article_last_autor": "Y Li",
"main_article_mid_authors": "",
"main_article_pub_date": "2007",
"main_article_title": "Simple fluorescent sensors engineered with catalytic DNA 'MgZ' based on a non-classic allosteric design.",
"metal_ions": [
"Mg2+"
],
"n": "60",
"name": "MgZ-9",
"notes": "",
"r": "",
"rate_constant": null,
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "specific cleavage at desired position",
"s": "cleavage in cis",
"structures": [],
"x": "Fluorescein (F)- and a DABCYL (Q)-modified deoxyribothymidine. ",
"yield": null
},
"1835": {
"buffer": "10 mM Mg2+, pH 7.5",
"e": "TCGACCAGGTCGGGGCCTGGAGGGGAGGCTATGCGAAGGTTTGGTGACGAGGCTGTAGGTCGGA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 64,
"linkage": "RNA phosphodiester",
"main_article_first_author": "W Chiuman",
"main_article_last_autor": "Y Li",
"main_article_mid_authors": "",
"main_article_pub_date": "2007",
"main_article_title": "Simple fluorescent sensors engineered with catalytic DNA 'MgZ' based on a non-classic allosteric design.",
"metal_ions": [
"Mg2+"
],
"n": "60",
"name": "MgZ-2",
"notes": "",
"r": "",
"rate_constant": null,
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "specific cleavage at desired position",
"s": "cleavage in cis",
"structures": [],
"x": "Fluorescein (F)- and a DABCYL (Q)-modified deoxyribothymidine. ",
"yield": null
},
"1836": {
"buffer": "10 mM Mg2+, pH 7.5",
"e": "TCAACCAGGTCGGGGCCCGGAGGGGAGGCTATGCGAAGGTTTGGTGACGAAGCTGTAGGTCGGA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 64,
"linkage": "RNA phosphodiester",
"main_article_first_author": "W Chiuman",
"main_article_last_autor": "Y Li",
"main_article_mid_authors": "",
"main_article_pub_date": "2007",
"main_article_title": "Simple fluorescent sensors engineered with catalytic DNA 'MgZ' based on a non-classic allosteric design.",
"metal_ions": [
"Mg2+"
],
"n": "60",
"name": "MgZ-8",
"notes": "",
"r": "",
"rate_constant": null,
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "specific cleavage at desired position",
"s": "cleavage in cis",
"structures": [],
"x": "Fluorescein (F)- and a DABCYL (Q)-modified deoxyribothymidine. ",
"yield": null
},
"1837": {
"buffer": "10 mM Mg2+, pH 7.5",
"e": "TCAACCAGGTCGGGGCCCGGAGGGGAGGCTATGTGAAGGTTTGGTGACGAAGTTGTAGGTCGGA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 64,
"linkage": "RNA phosphodiester",
"main_article_first_author": "W Chiuman",
"main_article_last_autor": "Y Li",
"main_article_mid_authors": "",
"main_article_pub_date": "2007",
"main_article_title": "Simple fluorescent sensors engineered with catalytic DNA 'MgZ' based on a non-classic allosteric design.",
"metal_ions": [
"Mg2+"
],
"n": "60",
"name": "MgZ-11",
"notes": "",
"r": "",
"rate_constant": null,
"reaction": "RNA cleavage",
"reported_in": "s",
"rp": "specific cleavage at desired position",
"s": "cleavage in cis",
"structures": [],
"x": "Fluorescein (F)- and a DABCYL (Q)-modified deoxyribothymidine. ",
"yield": null
},
"1838": {
"buffer": "10 mM Mg2+, pH 7.5",
"e": "TCAACCAGGTCGGGGCCGAAATATAATAGAAAGTGAAGATGTTTTGGGAGGCTAAGCTAGGAAG",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 64,
"linkage": "RNA phosphodiester",
"main_article_first_author": "W Chiuman",
"main_article_last_autor": "Y Li",
"main_article_mid_authors": "",
"main_article_pub_date": "2007",
"main_article_title": "Simple fluorescent sensors engineered with catalytic DNA 'MgZ' based on a non-classic allosteric design.",
"metal_ions": [
"Mg2+"
],
"n": "60",
"name": "MgZ-5",
"notes": "Subjected to reselection.",
"r": "",
"rate_constant": null,
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "cleavage in cis",
"structures": [],
"x": "Fluorescein (F)- and a DABCYL (Q)-modified deoxyribothymidine. ",
"yield": null
},
"1839": {
"buffer": "10 mM Mg2+, pH 7.5",
"e": "TCAAGGATTATTACCAGGTCGGGGCCAAATTAACGGGTATTGACATCGAGTTAATTAGGGAGGC",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 64,
"linkage": "RNA phosphodiester",
"main_article_first_author": "W Chiuman",
"main_article_last_autor": "Y Li",
"main_article_mid_authors": "",
"main_article_pub_date": "2007",
"main_article_title": "Simple fluorescent sensors engineered with catalytic DNA 'MgZ' based on a non-classic allosteric design.",
"metal_ions": [
"Mg2+"
],
"n": "60",
"name": "MgZ-7",
"notes": "Subjected to reselection.",
"r": "",
"rate_constant": null,
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "cleavage in cis",
"structures": [],
"x": "Fluorescein (F)- and a DABCYL (Q)-modified deoxyribothymidine. ",
"yield": null
},
"1840": {
"buffer": "10 mM Mg2+, pH 7.5",
"e": "TCAATGTAATCAAATGTCGTGAAGGGGTTTTGACGCCAGAGGGCGGAAATGTAAGGAGGATTGG",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 64,
"linkage": "RNA phosphodiester",
"main_article_first_author": "W Chiuman",
"main_article_last_autor": "Y Li",
"main_article_mid_authors": "",
"main_article_pub_date": "2007",
"main_article_title": "Simple fluorescent sensors engineered with catalytic DNA 'MgZ' based on a non-classic allosteric design.",
"metal_ions": [
"Mg2+-independent"
],
"n": "60",
"name": "G12SD-2",
"notes": "Arbitrarily chosen for further studies.",
"r": "",
"rate_constant": null,
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "cleavage in cis",
"structures": [],
"x": "Fluorescein (F)- and a DABCYL (Q)-modified deoxyribothymidine. ",
"yield": null
},
"1850": {
"buffer": "10 mM Mg2+, pH 7.5",
"e": "TCAACTGAACTATCTGGGGCAATCAGAGAATCGTAGGGTTTGAGGTTCGGTGGGTAGCATGGA",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "n",
"l": "",
"length": 63,
"linkage": "RNA phosphodiester",
"main_article_first_author": "W Chiuman",
"main_article_last_autor": "Y Li",
"main_article_mid_authors": "",
"main_article_pub_date": "2007",
"main_article_title": "Simple fluorescent sensors engineered with catalytic DNA 'MgZ' based on a non-classic allosteric design.",
"metal_ions": [
"Mg2+-independent"
],
"n": "60",
"name": "G12SD-1",
"notes": "Arbitrarily chosen for further studies.",
"r": "",
"rate_constant": null,
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "cleavage in cis",
"structures": [],
"x": "Fluorescein (F)- and a DABCYL (Q)-modified deoxyribothymidine. ",
"yield": null
},
"1861": {
"buffer": "",
"e": "ACATCATGCGAGCACACGCAATAGCCTGATAAGGTTGGTAG",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 41,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M A Carrigan",
"main_article_last_autor": "S A Benner",
"main_article_mid_authors": "A Ricardo, D N Ang",
"main_article_pub_date": "2004",
"main_article_title": "Quantitative analysis of a RNA-cleaving DNA catalyst obtained via in vitro selection.",
"metal_ions": [
"Mg2+-independent"
],
"n": "40",
"name": "614",
"notes": "The initial library was based on the sequence used by Breaker and Joyce (Breaker, R. R., and Joyce, G. F. (1995) A DNA enzyme with Mg2+-dependent RNA phosphoesterase activity, Chem. Biol. 2, 655-660) with an internal riboadenosine incorporated at position 28 to provide a cleavable linker. 614 catalyzes the cleavage of the ribo-adenosine embedded within the cat + ribose primer, either as a part of its own sequence or in trans. ",
"r": "",
"rate_constant": "kobs = 0.015 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "cleavage in cis*",
"structures": [],
"x": "",
"yield": null
},
"1862": {
"buffer": "",
"e": "ACACGCACGGACTTGTACGTATATAGCGTAAGGTTGATAG",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M A Carrigan",
"main_article_last_autor": "S A Benner",
"main_article_mid_authors": "A Ricardo, D N Ang",
"main_article_pub_date": "2004",
"main_article_title": "Quantitative analysis of a RNA-cleaving DNA catalyst obtained via in vitro selection.",
"metal_ions": [
"Mg2+-independent"
],
"n": "40",
"name": "62/615",
"notes": "The initial library was based on the sequence used by Breaker and Joyce (Breaker, R. R., and Joyce, G. F. (1995) A DNA enzyme with Mg2+-dependent RNA phosphoesterase activity, Chem. Biol. 2, 655-660) with an internal riboadenosine incorporated at position 28 to provide a cleavable linker.",
"r": "",
"rate_constant": "kobs = 0.049 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "cleavage in cis",
"structures": [],
"x": "",
"yield": null
},
"1863": {
"buffer": "",
"e": "ACTGCACAATCCAACACCGATTGCAAAGGTTGTTAGGG",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 38,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M A Carrigan",
"main_article_last_autor": "S A Benner",
"main_article_mid_authors": "A Ricardo, D N Ang",
"main_article_pub_date": "2004",
"main_article_title": "Quantitative analysis of a RNA-cleaving DNA catalyst obtained via in vitro selection.",
"metal_ions": [
"Mg2+-independent"
],
"n": "40",
"name": "616",
"notes": "The initial library was based on the sequence used by Breaker and Joyce (Breaker, R. R., and Joyce, G. F. (1995) A DNA enzyme with Mg2+-dependent RNA phosphoesterase activity, Chem. Biol. 2, 655-660) with an internal riboadenosine incorporated at position 28 to provide a cleavable linker.",
"r": "",
"rate_constant": "kobs = 0.034 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "cleavage in cis",
"structures": [],
"x": "",
"yield": null
},
"1864": {
"buffer": "",
"e": "TGTGCTAGGTGTTCTCTGAGCCAGACGTTAGTGTAGTTAAG",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 41,
"linkage": "RNA phosphodiester",
"main_article_first_author": "M A Carrigan",
"main_article_last_autor": "S A Benner",
"main_article_mid_authors": "A Ricardo, D N Ang",
"main_article_pub_date": "2004",
"main_article_title": "Quantitative analysis of a RNA-cleaving DNA catalyst obtained via in vitro selection.",
"metal_ions": [
"Mg2+"
],
"n": "40",
"name": "625",
"notes": "The initial library was based on the sequence used by Breaker and Joyce (Breaker, R. R., and Joyce, G. F. (1995) A DNA enzyme with Mg2+-dependent RNA phosphoesterase activity, Chem. Biol. 2, 655-660) with an internal riboadenosine incorporated at position 28 to provide a cleavable linker.",
"r": "",
"rate_constant": "kobs = 0.045 h-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "cleavage in cis",
"structures": [],
"x": "",
"yield": null
},
"1888": {
"buffer": "10 mM MgCl2, 0.5 M NaCl, 50 mM EPPS pH 7.5",
"e": "GCGAGAGTGGTTTAGGGACCGGCACTCGGAGTGCAGAGAGG",
"fg1s": [
"2'-OH of rG"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 41,
"linkage": "RNA phosphodiester*",
"main_article_first_author": "P Ordoukhanian",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "2002",
"main_article_title": "RNA-cleaving DNA enzymes with altered regio- or enantioselectivity.",
"metal_ions": [
"Mg2+"
],
"n": "50",
"name": "2\u2032:10-16",
"notes": "Cleaves a 2\u2032,5\u2032-linked beta-D-ribonucleotide. Made also to act in trans.",
"r": "",
"rate_constant": "kcat = 0.01 min-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "CCTCTCTGCAGTCGGACACTCTCGC",
"structures": [],
"x": "",
"yield": null
},
"1890": {
"buffer": "10 mM MgCl2, 0.5 M NaCl, 50 mM EPPS pH 7.5",
"e": "GCGAGAGTGGGGACCGGCCACTCGGAGTGCAGAGAGG",
"fg1s": [
"2'-OH of rG"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 37,
"linkage": "RNA phosphodiester*",
"main_article_first_author": "P Ordoukhanian",
"main_article_last_autor": "G F Joyce",
"main_article_mid_authors": "",
"main_article_pub_date": "2002",
"main_article_title": "RNA-cleaving DNA enzymes with altered regio- or enantioselectivity.",
"metal_ions": [
"Mg2+"
],
"n": "50",
"name": "2\u2032:15-2",
"notes": "Cleaves a 2\u2032,5\u2032-linked beta-D-ribonucleotide. Made also to act in trans.",
"r": "",
"rate_constant": "kcat = 0.034 min-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "CCTCTCTGCAGTCGGACACTCTCGC",
"structures": [],
"x": "",
"yield": null
},
"1926": {
"buffer": "50 mM Na.Hepes pH 7.0, 0.5 M NaCl, 10 mM Mg2+",
"e": "TCTCTTTCTGCGGAGGAGGTAGGGGTTCCGCTCCAAGGGC",
"fg1s": [
"2'-OH of rA"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 40,
"linkage": "RNA phosphodiester",
"main_article_first_author": "A R Feldman",
"main_article_last_autor": "D Sen",
"main_article_mid_authors": "",
"main_article_pub_date": "2001",
"main_article_title": "A new and efficient DNA enzyme for the sequence-specific cleavage of RNA.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "Bipartite I",
"notes": "A reselected variant with unchanged catalytic domain (Bipartite II) displays kcat = 1.4 min-1 in trans.",
"r": "",
"rate_constant": "kobs = 1.7 min-1",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "",
"s": "cleavage in cis",
"structures": [],
"x": "",
"yield": null
},
"1935": {
"buffer": "100 mM KCl, 400 mM NaCl, 50 mM Hepes pH 7.0 at 23 \u00b0C, 7.5 mM MgCl2, 7.5 mM MnCl2",
"e": "CAAATTGATCGGTGGGGAGCAACTGAAAGGCGGTTGCAATGCGGATGGATGGTACGGTC",
"fg1s": [
"2'-OH of rC"
],
"fg2s": [
"vicinal phosphate"
],
"kinetics": "y",
"l": "",
"length": 59,
"linkage": "RNA phosphodiester",
"main_article_first_author": "J C F Lam",
"main_article_last_autor": "Y Li",
"main_article_mid_authors": "J B Withers",
"main_article_pub_date": "2010",
"main_article_title": "A complex RNA-cleaving DNAzyme that can efficiently cleave a pyrimidine-pyrimidine junction.",
"metal_ions": [
"Mn2+",
"Mg2+"
],
"n": "40",
"name": "CT10-3.29T",
"notes": "Made to act in trans from CT10-3.29. Extensive structure probing data. Mutants of this DNAzyme achieve greater cleavage rates and higher yields, i.e. CT10.3.29M1 has kobs = 1.4 min-1.",
"r": "",
"rate_constant": "kobs = 0.34 min-1*",
"reaction": "RNA cleavage",
"reported_in": "m",
"rp": "specific cleavage at desired position",
"s": "GATGTGTCCGTGCTrCTGGTTCGATTTGTTT",
"structures": [],
"x": "",
"yield": "60"
}
}