tRNAmodpred


Results for job: Haloferax volcanii

Job id: de85a5f6-73c8-4c6f-84c2-fdf8241cf297
Applied phylogenetic filters:

Download text file with results Run knock-out analysis for this job Download input proteins fasta file


Query tRNA sequences:

accept| | D-domain ||anticodon domain || variable region || T-domain ||accept|
10| 20| 30| 40| 50| 60| 70|
Sequence name012345678901234567-890--1234567890123456789012345eeeeeeeeeeeeeeeeeee6789012345678901234567890123456
tRNA Ala CGC Haloferax volcanii prokaryotic cytosol-GGGCUCGUAGAUCAGU--GGC--AGAUCGCUUCCUUCGCAAGGAAGAG-------------------GCCCGGGGUUCAAAUCCCCGCGAGUCCACCA
tRNA Ala GGC Haloferax volcanii prokaryotic cytosol-GGGCUCGUAGAUCAGG--GGU--AGAUCACUCCCUUGGCAUGGGAGAG-------------------GCCCCGGGUUCAAAUCCCGGCGAGUCCACCA
tRNA Ala UGC Haloferax volcanii prokaryotic cytosol-GGGCCCAUAGCUCAGU--GGU--AGAGUGCCUCCUUUGCAAGGAGGAU-------------------GCCCAGGGUUCGAAUCCCUGUGGGUCCACCA
tRNA Cys GCA Haloferax volcanii prokaryotic cytosol-GCCAAGGUGGCAGAGUUCGGCCCAACGCAUCCGCCUGCAGAGCGGAAC-------------------C_CGCCGGUUCAAAUCCGGCCCUUGGCUCCA
tRNA Asp GUC Haloferax volcanii prokaryotic cytosol-GCCCGGGUGGUGUAGU--GGCCCAUCAUACGACCCUGUCACGGUCGUG-------------------A-CGCGGGUUCAAAUCCCGCCUCGGGCGCCA
tRNA Glu MUC Haloferax volcanii prokaryotic cytosol-GCUCUGUUGGUGUAGUCCGGCCAAUCAUAUCACCCUCUCACGGUGAUG-------------------A-CCAGGGUUCGAAUCCCUGACGGAGCACCA
tRNA Glu NUC Haloferax volcanii prokaryotic cytosol-GCUCGGUUGGUGUAGUCCGGCCAAUCAUCUUGGCCUUUCGAGCCGAGG-------------------A-CCAGGGUUCAAAUCCCUGACCGAGCACCA
tRNA Phe GAA Haloferax volcanii prokaryotic cytosol-GCCGCCUUAGCUCAGACUGGG--AGAGCACUCGACUGAAGAUCGAGCU-------------------GUCCCCGGUUCAAAUCCGGGAGGCGGCACCA
tRNA Gly CCC Haloferax volcanii prokaryotic cytosol-GCGCCGAUGGUCCAGU--GGU--AGGACACGAGCUUCCCAAGCUCGGA-------------------G-CCCGGGUUCAAUUCCCGGUCGGCGCACCA
tRNA Gly GCC Haloferax volcanii prokaryotic cytosol-GCGUCGGUAGUGUAGU--GGU--AUCACGUGACCUUGCCAUGGUCACA-------------------A-CCUGGGUUCAAAUCCCAGCCGACGCACCA
tRNA Gly2 GCC Haloferax volcanii prokaryotic cytosol-GCGCUGGUAGUGUAGU--GGU--AUCACGUGACCUUGCCAUGGUCACA-------------------A-CCUGGGUUCAAAUCCCAGCCAGCGCACCA
tRNA Gly NCC Haloferax volcanii prokaryotic cytosol-GCACCGGUGGUCUAAU--GGU--AAGACAUUGGCCUUCCAAGCCAAUU-------------------A-UCUGGGUUCGAUUCCCAGCCGGUGCACCA
tRNA His GUG Haloferax volcanii prokaryotic cytosolGUCCGGGUUGGGGUAGU--GGACUAUCCUUCAGCCUUGUGGAGGCUGAG-------------------A-CGCGGGUUCAAUUCUCGCACCUGGACCCA
tRNA Ile GAU Haloferax volcanii prokaryotic cytosol-GGGCCAAUAGCUCAGUCAGGUU--GAGCGCUCGGCUGAUAACCGGGAG-------------------GCCCGCGGUUCAAAUCCGCGUUGGCCCACCA
tRNA Ile NAU Haloferax volcanii prokaryotic cytosol-GGGCCCCUAGCUCAGUCUGGUC-AGAGCGCUCGGCUUAUAACCGGGUG-------------------GUCAUGGGUUCGAACCCCAUGGGGCCCACCA
tRNA Lys NUU Haloferax volcanii prokaryotic cytosol-GGGCUGGUAGCUCAGUUAGGC--AGAGCGUCUGGCUUUUAACCAGACG-------------------GUCGGGGGUUCAAGUCCCUCCCAGCCCGCCA
tRNA Lys MUU Haloferax volcanii prokaryotic cytosol-GGGCCGGUAGCUCAGUUAGGC--AGAGCGUCUGACUCUUAAUCAGACG-------------------GUCGCGUGUUCAAAUCGCGUCCGGCCCACCA
tRNA Leu CAA Haloferax volcanii prokaryotic cytosol-GCGAGGGUAGCUAAGUCAGGAA-AAAGCGGCGGACUCAAGAUCCGCU-CCC----GUAG-----GGGUCCGUGGGUUCAAAUCCCUCCCCUCGCACCA
tRNA Leu CAG Haloferax volcanii prokaryotic cytosol-GCAGGGAUAGCCAAGUCUGGCCAACGGCGCAGCGUUCAGGGCGCUGU-CUC----AUAG-----GAGUCCGCAGGUUCAAAUCCUGCUCCCUGCACCA
tRNA Leu GAG Haloferax volcanii prokaryotic cytosol-GCGUGGGUAGCCAAGCCAGGCCAACGGCGCAGCGUUGAGGGCGCUGU-CCU----GUAG-----AGGUCCGCCGGUUCAAAUCCGGUCCCACGCACCA
tRNA Leu UAA Haloferax volcanii prokaryotic cytosol-GCGGGGGUGGCUGAGCCAGGCCAAAAGCGGCGGACUUAAGAUCCGCU-CCC----GUAG-----GGGUUCGCGAGUUCGAAUCUCGUCCCCCGCACCA
tRNA Leu 5AG Haloferax volcanii prokaryotic cytosol-GCGCGGGUAGCCAAGU--GGCCAAAGGCGCAGCGCUUAGGACGCUGU-GGU----GUAG-----ACCUUCGCAGGUUCGAACCCUGUCCCGCGCACCA
tRNA Met BAU Haloferax volcanii prokaryotic cytosol-GCCCGGGUGGCUUAGCU-GGAC-AUAGCGCCGCACUCAUAAUGCGGAG-------------------AUCGUGGGUUCGGAGCCCACCCCGGGCACCA
tRNA Asn GUU Haloferax volcanii prokaryotic cytosol-GCCGCCGUAGCUCAGUU-GGU--AGAGCACCUCGCUGUUAACGAGGUU-------------------GUCCCAGGUUCGAGUCCUGGCGGUGGCGCCA
tRNA Pro MGG Haloferax volcanii prokaryotic cytosol-GGGCCGGUGGGGUAGCUUGGU--AUCCUUCGGCCUUCGGGUGGCCGUA-------------------A-CCUCAGUUCGAAUCUGAGCCGGCCCACCA
tRNA Pro GGG Haloferax volcanii prokaryotic cytosol-GGGACCGUGGGGUAGU--GGU--AUCCUCUGCCGAUGGGGUCGGUAGG-------------------A-CCUGAGUUCGACUCUCAGCGGUCCCACCA
tRNA Pro UGG Haloferax volcanii prokaryotic cytosol-GGGACCGUGGGUUAGCCUGGU--AUACUUCGGGCCUUGGGUGCCCGUG-------------------A-CCCCGGUUCAAAUCCGGGCGGUCCCACCA
tRNA Gln MUG Haloferax volcanii prokaryotic cytosol-AGUCCCAUGGGGUAGU--GGCCAAUCCUGUUGCCUUCUGGGGGCAACG-------------------A-CCCAGGUUCGAAUCCUGGUGGGACUACCA
tRNA Arg CCG Haloferax volcanii prokaryotic cytosol-GGGCCCGUAGCUCAGU--GGAC-AGAGUGCUUGGUUCCGGACCAAGAU-------------------GCCGCGGGUUCAAAUCCCGUCGGGUCCGCCA
tRNA Arg GCG Haloferax volcanii prokaryotic cytosol-GUCCUGAUAGGGUAGU--GGACUAUCCUCCUGGCUUGCGGAGCCAGGG-------------------A-CCGGAGUUCAAAUCUCCGUCAGGACGCCA
tRNA Arg NCG Haloferax volcanii prokaryotic cytosol-GGGCGCUUAGCUCAGUCUGGAC-AGAGUGCUUGGCUUCGGACCAAGUU-------------------GCCACGGGUUCAAAUCCUGUAGCGCCCACCA
tRNA Ser GCU Haloferax volcanii prokaryotic cytosol-GUUGCGGUAGCCAAGCCUGGCCCAAGGCGCUGGGUUGCUAACUCAGU-GGC----GUCAA----GCCC-CCGGGGUUCGAAUCCCCGCCGCAACGCCA
tRNA Ser MGA Haloferax volcanii prokaryotic cytosol-GCCGAGGUAGCCUAGCCCGGCC-AAGGCGGUAGAUUCGAAAUCUACU-GUCC---AUUC----GGACA-CGUGAGUUCAAAUCUCACCCUCGGCGCCA
tRNA Ser GGA Haloferax volcanii prokaryotic cytosol-GCCAGGAUGGCCGAGC--GGU--AAGGCGCACGCCUGGAAAGCGUGU-UCCC---UCU-----GGGAU-CGGGGGUUCAAAUCCCUCUCCUGGCGCCA
tRNA Thr CGU Haloferax volcanii prokaryotic cytosol-GCCGGUGUAGCUCAGUU-GGC--AGAGCGAUUCCUUCGUAAGGAAUAG-------------------GCCGAGGGUUCAAAUCCCUCCACCGGCUCCA
tRNA Thr GGU Haloferax volcanii prokaryotic cytosol-GCCUGGGUAGCUUAGC--GGU--AAAGCGCGUCCUUGGUAAGGACGAG-------------------ACCCCGGGUUCAAAUCCCGGCCUAGGCUCCA
tRNA Val CAC Haloferax volcanii prokaryotic cytosol-GGGUUGGUGGUCUAGCCAGGUU-AUGACGGCUCCUUCACACGGAGCAG-------------------GCCGGCGGUUCGAAUCCGCCCCAACCCACCA
tRNA Val GAC Haloferax volcanii prokaryotic cytosol-GGGUUGGUGGUCUAGUCUGGUU-AUGACACCUCCUUGACAUGGAGGAG-------------------GCCGGCAGUUCAAAUCUGCCCCAACCCACCA
tRNA Trp BCA Haloferax volcanii prokaryotic cytosol-GGGGCUGUGGCCAAGCCCGGC--AUGGCGACUGACUCCAGAUCAGUCG-------------------AUCGGGGGUUCAAAUCCCUCCGGCCCCACCA
tRNA Ini CAU Haloferax volcanii prokaryotic cytosol-AGCGGGAUGGGAUAGCCAGGAG-AUUCCGCCGGGCUCAUAACCCGGAG-------------------AUCGGUAGUUCAAAUCUACCUCCCGCUACCA
tRNA Tyr GUA Haloferax volcanii prokaryotic cytosol-CCGCUCUUAGCUCAGCCUGGC--AGAGCAGCCGACUGUAGAUCGGCUU-------------------GUCCCCCGUUCAAAUCGGGGAGAGCGGACCA