tRNAmodpred


Results for job: Saccharomyces cerevisiae

Job id: 78ca6ad6-29b7-487c-9d7e-3aaafda22ffb
Applied phylogenetic filters:

Download text file with results Run knock-out analysis for this job Download input proteins fasta file


Query tRNA sequences:

accept| | D-domain ||anticodon domain || variable region || T-domain ||accept|
10| 20| 30| 40| 50| 60| 70|
Sequence name012345678901234567-890--1234567890123456789012345eeeeeeeeeeeeeeeeeee6789012345678901234567890123456
tRNA Ala AGC Saccharomyces cerevisiae cytosolic-GGGCGUGUGGCGUAGUC-GGU--AGCGCGCUCCCUUAGCAUGGGAGAG-------------------GUCUCCGGUUCGAUUCCGGACUCGUCCACCA
tRNA Ala UGC Saccharomyces cerevisiae cytosolic-GGGCACAUGGCGCAGUU-GGU--AGCGCGCUUCCCUUGCAAGGAAGAG-------------------GUCAUCGGUUCGAUUCCGGUUGCGUCCACCA
tRNA Arg UCU Saccharomyces cerevisiae cytosolic-GCUCGCGUGGCGUAAU--GGC--AACGCGUCUGACUUCUAAUCAGAAG-------------------AUUAUGGGUUCGACCCCCAUCGUGAGUGCCA
tRNA Arg ICG Saccharomyces cerevisiae cytosolic-UUCCUCGUGGCCCAAU--GGUC-ACGGCGUCUGGCUACGAACCAGAAG-------------------AUUCCAGGUUCAAGUCCUGGCGGGGAAGCCA
tRNA Arg CCU Saccharomyces cerevisiae cytosolic-GUUCCGUUGGCGUAAU--GGU--AACGCGUCUCCCUCCUAAGGAGAAG-------------------ACUGCGGGUUCGAGUCCCGUACGGAACGCCA
tRNA Asn GUU Saccharomyces cerevisiae cytosolic-GACUCCAUGGCCAAGUU-GGUU-AAGGCGUGCGACUGUUAAUCGCAAG-------------------AUCGUGAGUUCAACCCUCACUGGGGUCGCCA
tRNA Asp GUC Saccharomyces cerevisiae cytosolic-UCCGUGAUAGUUUAAU--GGUC-AGAAUGGGCGCUUGUCGCGUGCCAG-------------------A-UCGGGGUUCAAUUCCCCGUCGCGGAGCCA
tRNA Cys GCA Saccharomyces cerevisiae cytosolic-GCUCGUAUGGCGCAGU--GGU--AGCGCAGCAGAUUGCAAAUCUGUUG-------------------GUCCUUAGUUCGAUCCUGAGUGCGAGCUCCA
tRNA Gln UUG Saccharomyces cerevisiae cytosolic-GGUCCUAUAGUGUAGU--GGUU-AUCACUUUCGGUUUUGAUCCGGACA-------------------A-CCCCGGUUCGAAUCCGGGUAGGACCUCCA
tRNA Glu UUC Saccharomyces cerevisiae cytosolic-UCCGAUAUAGUGUAAC--GGCU-AUCACAUCACGCUUUCACCGUGGAG-------------------A-CCGGGGUUCGACUCCCCGUAUCGGAGCCA
tRNA Glu CUC Saccharomyces cerevisiae cytosolic-UCCGAUGUAGUGUAAC--GGCU-AUCACAUCACGUUCUCACCGUGGAG-------------------A-CCGGGGUUCGACUCCCCGCUUCGGAGCCA
tRNA Gly GCC Saccharomyces cerevisiae cytosolic-GCGCAAGUGGUUUAGU--GGU--AAAAUCCAACGUUGCCAUCGUUGGG-------------------C-CCCCGGUUCGAUUCCGGGCUUGCGCACCA
tRNA Gly UCC Saccharomyces cerevisiae cytosolic-GGGCGGUUAGUGUAGU--GGUU-AUCAUCCCACCCUUCCAAGGUGGGG-------------------A-CACGGGUUCGAUUCUCGUACCGCUCACCA
tRNA His1 GUG Saccharomyces cerevisiae cytosolicGGCCAUCUUAGUAUAGU--GGUU-AGUACACAACAUUGUGGCUGUUGAA-------------------A-CCCUGGUUCGAUUCUAGGAGGUGGCACCA
tRNA His2 GUG Saccharomyces cerevisiae cytosolicGGCCAUCUUAGUAUAGU--GGUU-AGUACACAUCGUUGUGGCCGAUGAA-------------------A-CCCUGGUUCGAUUCUAGGAGAUGGCACCA
tRNA Ile AAU Saccharomyces cerevisiae cytosolic-GGUCUCUUGGCCCAGUU-GGUU-AAGGCACCGUGCUAAUAACGCGGGG-------------------AUCAGCGGUUCGAUCCCGCUAGAGACCACCA
tRNA Ile UAU Saccharomyces cerevisiae cytosolic-GCUCGUGUAGCUCAGU--GGUU-AGAGCUUCGUGCUUAUAACGCGACC-------------------GUCGUGGGUUCAAUCCCCACCUCGAGCACCA
tRNA Leu UAG Saccharomyces cerevisiae cytosolic-GGGAGUUUGGCCGAGU--GGUUUAAGGCGUCAGAUUUAGGCUCUGAU-AUC----UUCG-----GAUG-CAAGGGUUCGAAUCCCUUAGCUCUCACCA
tRNA Leu CAA Saccharomyces cerevisiae cytosolic-GGUUGUUUGGCCGAGC--GGUCUAAGGCGCCUGAUUCAAGCUCAGGU-AUC----GUAA-----GAUG-CAAGAGUUCGAAUCUCUUAGCAACCACCA
tRNA Leu UAA Saccharomyces cerevisiae cytosolic-GGAGGGUUGGCCGAGU--GGUCUAAGGCGGCAGACUUAAGAUCUG-UUGGAC---GGUU----GUCC-GCGCGAGUUCGAACCUCGCAUCCUUCACCA
tRNA Lys CUU Saccharomyces cerevisiae cytosolic-GCCUUGUUGGCGCAAUC-GGU--AGCGCGUAUGACUCUUAAUCAUAAG-------------------GUUAGGGGUUCGAGCCCCCUACAGGGCUCCA
tRNA Lys 3UU Saccharomyces cerevisiae cytosolic-UCCUUGUUAGCUCAGUU-GGU--AGAGCGUUCGGCUUUUAACCGAAAU-------------------GUCAGGGGUUCGAGCCCCCUAUGAGGAGCCA
tRNA Met CAU Saccharomyces cerevisiae cytosolic-GCUUCAGUAGCUCAGUA-GGA--AGAGCGUCAGUCUCAUAAUCUGAAG-------------------GUCGAGAGUUCGAACCUCUCCUGGAGCACCA
tRNA Phe1 GAA Saccharomyces cerevisiae cytosolic-GCGGAUUUAGCUCAGUU-GGG--AGAGCGCCAGACUGAAGAUCUGGAG-------------------GUCCUGUGUUCGAUCCACAGAAUUCGCACCA
tRNA Phe2 GAA Saccharomyces cerevisiae cytosolic-GCGGACUUAGCUCAGUU-GGG--AGAGCGCCAGACUGAAGAUCUGGAG-------------------GUCCUGUGUUCGAUCCACAGAGUUCGCACCA
tRNA Pro UGG Saccharomyces cerevisiae cytosolic-GGGCGUGUGGUCUAGU--GGU--AUGAUUCUCGCUUUGGGUGCGAGAG-------------------GCCCUGGGUUCAAUUCCCAGCUCGCCCCCCA
tRNA Ser CGA Saccharomyces cerevisiae cytosolic-GGCACUAUGGCCGAGU--GGUU-AAGGCGAGAGACUCGAAAUCUCUU-GGGC---UCU-----GCCCG-CGCUGGUUCAAAUCCUGCUGGUGUCGCCA
tRNA Ser UGA Saccharomyces cerevisiae cytosolic-GGCACUAUGGCCGAGU--GGUU-AAGGCGACAGACUUGAAAUCUGUU-GGGC---UCU-----GCCCG-CGCUGGUUCAAAUCCUGCUGGUGUCGCCA
tRNA Ser1 IGA Saccharomyces cerevisiae cytosolic-GGCAACUUGGCCGAGU--GGUU-AAGGCGAAAGAUUAGAAAUCUUUU-GGGC---UCU-----GCCCG-CGCAGGUUCAAAUCCUGCAGUUGUCGCCA
tRNA Ser2 IGA Saccharomyces cerevisiae cytosolic-GGCAACUUGGCCGAGU--GGUU-AAGGCGAAAGAUUAGAAAUCUUUU-GGGC---UUU-----GCCCG-CGCAGGUUCGAGUCCUGCAGUUGUCGCCA
tRNA Ser GCU Saccharomyces cerevisiae cytosolic-GUCCCAGUGGCCGAGU--GGUU-AAGGCGAUGCCCUGCUAAGGCAUU-GGGU---UUU-----ACCUG-CGCAGGUUCGAAUCCUGUCUGUGACGCCA
tRNA Thr1 AGU Saccharomyces cerevisiae cytosolic-GCUUCUAUGGCCAAGUU-GGU--AAGGCGCCACACUAGUAAUGUGGAG-------------------AUCAUCGGUUCAAAUCCGAUUGGAAGCACCA
tRNA Thr2 AGU Saccharomyces cerevisiae cytosolic-GCUUCUAUGGCCAAGUU-GGU--AAGGCGCCACACUAGUAAUGUGGAG-------------------AUCGUCGGUUCAAAUCCGACUGGAAGCACCA
tRNA Trp CCA Saccharomyces cerevisiae cytosolic-GAAGCGGUGGCUCAAU--GGU--AGAGCUUUCGACUCCAAAUCGAAGG-------------------GUUGCAGGUUCAAUUCCUGUCCGUUUCACCA
tRNA Tyr GUA Saccharomyces cerevisiae cytosolic-CUCUCGGUAGCCAAGUU-GGUUUAAGGCGCAAGACUGUAAAUCUUGAG-------------------AUCGGGCGUUCGACUCGCCCCCGGGAGACCA
tRNA Val UAC Saccharomyces cerevisiae cytosolic-GGUCCAAUGGUCCAGU--GGUUCAAGACGUCGCCUUUACACGGCGAAG-------------------AUCCCGAGUUCGAACCUCGGUUGGAUCACCA
tRNA Val CAC Saccharomyces cerevisiae cytosolic-GUUCCAAUAGUGUAGC--GGCU-AUCACGUUGCCUUCACACGGCAAAG-------------------GUCCCGAGUUCGAUCCUCGGUUGGAACACCA
tRNA Val AAC Saccharomyces cerevisiae cytosolic-GGUUUCGUGGUCUAGUC-GGUU-AUGGCAUCUGCUUAACACGCAGAAC-------------------GUCCCCAGUUCGAUCCUGGGCGAAAUCACCA
tRNA Ini1 CAU Saccharomyces cerevisiae cytosolic-AGCGCCGUGGCGCAGU--GGA--AGCGCGCAGGGCUCAUAACCCUGAU-------------------GUCCUCGGAUCGAAACCGAGCGGCGCUACCA
tRNA Ini2 CAU Saccharomyces cerevisiae cytosolic-GGCGCCGUGGCGCAGU--GGA--AGCGCGCAGGGCUCAUAACCCUGAU-------------------GUCCUCGGAUGGAAACCGAGCGGCGCUACCA
tRNA Ile GAU Saccharomyces cerevisiae mitochondrial-GAAACUAUAAUUCAAUU-GGUU-AGAAUAGUAUUUUGAUAAGGUACAA-------------------A-UAUAGGUUCAAUCCCUGUUAGUUUCACCA
tRNA Leu !AA Saccharomyces cerevisiae mitochondrial-GCUAUUUUGGUGGAAUU-GGUA-GACACGAUACUCUUAAGAUGUAUU-ACU----UUAC-----AGUA-UGAAGGUUCAAGUCCUUUAAAUAGCACCA
tRNA Lys $UU Saccharomyces cerevisiae mitochondrial-GAGAAUAUUGUUUAAU--GGU--AAAACAGUUGUCUUUUAAGCAACCC-------------------A-UGC_GGUUCAACUCCAGCUAUUCUCACCA
tRNA Met CAU Saccharomyces cerevisiae mitochondrial-GCUUGUAUAGUUUAAUU-GGUU-AAAACAUUUGUCUCAUAAAUAAAUA-------------------AUGUAAGGUUCAAUUCCUUCUACAAGUACCA
tRNA Ser GCU Saccharomyces cerevisiae mitochondrial-GGAAAAUUAACUAUA---GGU--AAAGU_AUUAUUUGCUAAGUAAUU-GAAUU--GUA----AAUUCU-UAUGAGUUCGAAUCUCAUAUUUUCCGCCA
tRNA Tyr GUA Saccharomyces cerevisiae mitochondrial-GGAGGGAUUUUCAAUGUUGGUAGUUGGAGUUGAGCUGUAAACUCAAU-GACU---UA------GGUCUUCAUAGGUUCAAUUCCUAUUCCCUUCACCA
tRNA Ini CAU Saccharomyces cerevisiae mitochondrial-UGCAAUAUGAUGUAAUU-GGUU-AACAUUUUAGGGUCAUGACCUAAUU-------------------A-UAUACGUUCAAAUCGUAUUAUUGCUACCA
tRNA Phe GAA Saccharomyces cerevisiae mitochondrial-GCUUUUAUAGCUUAGU--GGU--AAAGCGAUAAAUUGAAGAUUUAUUU-------------------A-CAU_AGUUCGAUUCUCAUUAAGGGCACCA
tRNA Gly NCC Saccharomyces cerevisiae mitochondrial-AUAGAUAUAAGUUAAUU-GGU--AAACUGGAUGUCUUCCAAACAUUGA-------------------A-UGCGAGUUCGAUUCUCGCUAUCUAUACCA
tRNA His GUG Saccharomyces cerevisiae mitochondrialGGUGAAUAUAUUUCAAU--GGU--AGAAAAUACGCUUGUGGUGCGUUAA-------------------A-UCUGAGUUCGAUUCUCAGUAUUCACCCCA
tRNA Pro UGG Saccharomyces cerevisiae mitochondrial-CAGAUAGAAGCCAAAA--GGU--CAGGCGCUUUCUUUGGGAGAAAGAC-------------------CUAGUUAGUUCGAGUCUAUCCUAUCUGACCA
tRNA Arg ACG Saccharomyces cerevisiae mitochondrial-AUAUCUUUAAUUUAAU--GGU--AAAAUAUUAGAAUACGAAUCUAAUU-------------------A-UAUAGGUUCAAAUCCUAUAAGAUAUUCCA
tRNA Arg NCU Saccharomyces cerevisiae mitochondrial-GCUCUCUUAGCUUAAU--GGUU-AAAGCAUAAUACUUCUAAUAUUAAU-------------------AUUCCAUGUUCAAAUCAUGGAGAGAGUACCA
tRNA Ser1 UGA Saccharomyces cerevisiae mitochondrial-GGAUGGUUGACUGAGU--GGUUUAAAGUGUGAUAUUUGAGCUAUCAU-UAGUCU-UUAU--UGGCUA--CGUAGGUUCAAAUCCUACAUCAUCCGCCA
tRNA Ser2 UGA Saccharomyces cerevisiae mitochondrial-GGAUGGUUGACUGAGU--GGUUUAAAGUGUGAUAUUUGAGCUAUCAU-UAGUCU-UUAU--UGGCUA--CGUAGGUUCAAAUCCUACAUCAUCCGCCA
tRNA Thr UAG Saccharomyces cerevisiae mitochondrial-GUAAAUAUAAUUUAAU--GGU--AAAAUGUAUGU_UUAGGUGCAUAUU-------------------A-UCUAAGUUCAAAUCUUAGUAUUUACACCA
tRNA Trp !CA Saccharomyces cerevisiae mitochondrial-AAGGAUAUAGUUUAAU--GGU--AAAACAGUUGAUUUCAAAUCAAUCA-------------------U-UAGGAGUUCGAAUCUCUUUAUCCUUGCCA